...

ecol409.2008.lecture6 - Ecology and Evolutionary Biology

by user

on
Category:

aids and hiv

11

views

Report

Comments

Transcript

ecol409.2008.lecture6 - Ecology and Evolutionary Biology
The emergence of pathogenic
viruses: an evolutionary
approach
Michael Worobey
Department of Ecology and Evolutionary Biology,
University of Arizona
August 25, 2008
Questions:
(1) Where did HIV come from?
(2) When, where, and how did HIV-1 first emerge from subSaharan Africa?
(3) When and how did the pandemic AIDS virus jump to
humans and begin its spread?
(4) What factors mediate the emergence of new flu lineages?
1: The origin of HIV
HIV/AIDS basics
Where did AIDS come from?
• First identified in US gay males in the early
1980s, severe immunosuppression
QuickTime™ and a
TIFF (Uncompressed) decompressor
are needed to see this picture.
• Pneumocystis carinii pneumonia
• Other rare opportunistic infections, horrendous
suffering and death
Randy Shilts
As a national correspondent for the San Francisco
Chronicle, Shilts was the first newspaper reporter to
cover the AIDS epidemic full time. In his book And the
Band Played On—AIDS: The First Five Years (19801985), he took almost everyone to task on how the first
years of the epidemic were handled
QuickTime™ and a
TIFF (Uncompressed) decompressor
are needed to see this picture.
HIV/AIDS basics
Early history
QuickTi me™ and a
TIFF ( Uncompressed) decompressor
are needed to see thi s pi ctur e.
•
New syndrome recognized by 1981
•
Retroviral agent isolated in 1983
•
Sexually transmitted, but also via needles, transfusions, birth
•
Hit these risk groups hard in the US, but also high prevalence
in Haiti, Central Africa
Françoise
Barre-Sinoussi
HIV/AIDS basics
• Viruses are made up of a set of
genetic instructions wrapped
inside a protective shell
• HIV is particularly succinct at
around 3000 amino acid
residues that hijack the cell’s
own machinery
• Genome is in the form of
RNA, so it also includes a
reverse transcriptase (RNA to
DNA enzyme)
• About 20 % of your genome is
made up of similar “selfish
DNA” (more than 10X the
amount of your 30,000 protein
genes)
HIV/AIDS basics
HIV/AIDS basics
Evolution in the fast lane:
•
About 10 billion virions are generated daily in an infected host
(2.5 days per cycle)
•
Each has a compact genome made up of about 10,000
nucleotides
•
Approximately one mutation is generated for each new
genome
•
Every possible mutation occurs every day
HIV/AIDS basics
Current status: Disaster
Origins of HIV/AIDS
The past…
Where did HIV/AIDS come from?
Origins of HIV/AIDS
Where did HIV come from?
•
•
•
•
•
•
•
Divine retribution
Doesn’t matter--it doesn’t cause AIDS
Conspiracy theories - e.g. the CIA did it
Voodoo rituals
Ritualistic use of monkey blood
Contamination of vaccines
Zoonosis (a disease communicable from animals to humans under natural
conditions)
How can we
discriminate between
these hypotheses?
Origins of HIV/AIDS
Where did HIV come from?
• Divine retribution
“The poor homosexuals--they have declared war upon nature, and now nature is
exacting an awful retribution”
-Pat Buchanan
"With 80,000 dead of AIDS, our promiscuous homosexuals appear literally hell-bent on
Satanism and suicide”
-Pat Buchanan
"AIDS is not just God's punishment for homosexuals; it is God's punishment for the
society that tolerates homosexuals.”
-Jerry Falwell
“Grown men should not be having sex with prostitutes, unless they are married to them”
-Jerry Falwell
QuickTi me™ a nd a
TIFF (Uncompre ssed ) decomp resso r
are need ed to se e th is p icture.
Origins of HIV/AIDS
Where did HIV come from?
• Divine retribution
“The poor homosexuals--they have declared war upon nature, and now nature is
exacting an awful retribution”
-Pat Buchanan
"With 80,000 dead of AIDS, our promiscuous homosexuals appear literally hell-bent on
Satanism and suicide”
-Pat Buchanan
"AIDS is not just God's punishment for homosexuals; it is God's punishment for the
society that tolerates homosexuals.”
-Jerry Falwell
“Grown men should not be having sex with prostitutes, unless they are married to them”
-Jerry Falwell
QuickTi me™ a nd a
TIFF (Uncompre ssed ) decomp resso r
are need ed to se e th is p icture.
Origins of HIV/AIDS
Where did HIV come from?
• Doesn’t matter--it doesn’t cause AIDS
Origins of HIV/AIDS
Where did HIV come from?
• Doesn’t matter--it doesn’t cause AIDS
Origins of HIV/AIDS
•
•
•
•
•
Divine retribution
Doesn’t matter--it doesn’t cause AIDS
Conspiracy theories - e.g. the CIA did it
Ritualistic use of monkey blood
Zoonosis (a disease communicable from animals to man
under natural conditions)
• Contamination of vaccines
•
THE PLAUSIBLE HYPOTHESES ALL HAVE IN COMMON THE
INCRIMINATION OF SIMIAN IMMUNODEFICIENCY VIRUSES
(SIVcpz) FROM CHIMPANZEES
•
THE KEY DISCOVERY WAS THE FINDING THAT AFRICAN PRIMATES
ARE INFECTED WITH SIMILAR VIRUSES…
HIV/AIDS basics
Early history
QuickTi me™ and a
TIFF ( Uncompressed) decompressor
are needed to see thi s pi ctur e.
•
New syndrome recognized by 1981
•
Retroviral agent isolated in 1983
•
Sexually transmitted, but also via needles, transfusions, birth
•
Hit these risk groups hard in the US, but also high prevalence
in Haiti, Central Africa
Françoise
Barre-Sinoussi
Origins of HIV/AIDS
Where did HIV come from?
•
•
•
•
•
•
•
Divine retribution
Doesn’t matter--it doesn’t cause AIDS
Conspiracy theories - e.g. the CIA did it
Voodoo rituals
Ritualistic use of monkey blood
Contamination of vaccines
Zoonosis (a disease communicable from animals to humans under natural
conditions)
How can we
discriminate between
these hypotheses?
Key discovery: SIVs are found naturally in African primates
SIVcpz
x
HIV-1/O
SIVcpz
x
HIV-1/N
x
Pan troglodytes
HIV-1/M
SIVagmTAN
SIVagmGRI
Chlorocebus aethiops
SIVagmVER
SIVsyk
x
x
Cercopithecus
albogularis
HIV-2/B
HIV-2/A
SIVsm
SIVmnd
Cercocebus
atys
SIVlhoest
Cercopithecus
lhoesti
SIVsun
SIVcol
0.1
Colobus guereza
Origins of HIV/AIDS
•
•
•
•
•
Divine retribution
Doesn’t matter--it doesn’t cause AIDS
Conspiracy theories - e.g. the CIA did it
Ritualistic use of monkey blood
Zoonosis (a disease communicable from animals to man
under natural conditions)
• Contamination of vaccines
•
THE PLAUSIBLE HYPOTHESES ALL HAVE IN COMMON THE
INCRIMINATION OF SIMIAN IMMUNODEFICIENCY VIRUSES
(SIVcpz) FROM CHIMPANZEES
•
THE KEY DISCOVERY WAS THE FINDING THAT AFRICAN PRIMATES
ARE INFECTED WITH SIMILAR VIRUSES…
Origins of HIV/AIDS
Origins of HIV/AIDS
A direct test: non-invasive sampling of SIVcpz from the
supposed “source” (and a big blank space on the map of
SIVcpz distribution)
Origins of HIV/AIDS
Origins of HIV/AIDS
Phylogenetic position
Expected for source population
Phylogenetic
position of
Kisangani SIV
Worobey et al. 2004
Extensive non-invasive sampling continues:
•>1500 samples
collected from across
DRC
•212 SIVcpz Ab
positive
•22 SIVcpz RNA
positive
Worobey, Hahn, Li, Ndjango,
unpublished results
2: The Worldwide Emergence of
HIV-1
HIV-1 group M Diversity
B RF
B LAI
D 94UG114
D ELI
A 92UG037
A U455
G SE6165
G 92NG083
J SE9280
J SE9173
C ETH2220
C 92BR025
H VI991
H 90CF056
K MP535
K EQTB11
F1 VI850
F1 93BR020
F2 MP255
F2 MP257
SIVcpz/US
SIVcpz/Cam5
N YBF30
N YBF106
SIVcpz/Gab1
O ANT70
O MVP1580
SIVcpz/Ant
subtypes
Subtypes A-K
30% amino acid
divergence in Env
between subtypes
Utility:
Tracing the
global pandemic
Documenting
recombination
Molecular Epidemiology of HIV-1 group M
Revisiting an old hypothesis…
Questions:
Did HIV-1 move from Haiti to US, or US to Haiti?
When and how did these events take place?
Approach:
•Archival Haitian-linked samples, Pitchenik et al, AIM,
1983
•Some of the earliest known AIDS patients in the US
(Haitian immigrants to the US 1970s/80s)
•Full-length env alignment of published B and D
subtype sequences (117 B plus 5 D)
•Bayesian MCMC approach, MrBayes and BEAST
Phylogenetic patterns under different scenarios:
Haiti first
Simultaneous
US first
Unknowable
Results: the Emergence of HIV-1 in the Americas
Posterior probability
of Haitian origin =
0.999
n = 13
Posterior probability of Trinidad &
Tobago clade = 1.0
n = 96
Posterior probability of “pandemic
clade” = 1.0
Gilbert et al. 2007, PNAS
Estimating rates of viral evolution
Synonymous, dS = 10 x 10-3/site/year
Nonsynonymous, dN = 2-5 x 10-3/site/year
Mutation rate : 3.4 x 10-5 /site/replication
Replications : about 300/year
300 x 3.4 x 10-5 = 10.2 x 10-3
Average: 5 x 10-3/site/year
divergence rate: 1% /site/year
Rate = d
t
Using the “molecular clock”
Calibrate the clock
Correct for multiple hits
Account for methodological
bias
The Emergence of HIV-1/AIDS in the Americas: when?
Posterior probability of
Haitian origin = 0.998
1969 [1966-72]
Conclusions:
It’s not a sampling artifact: the B epidemic is older in Haiti, >40
years
Timing fits well with large movement of people between Haiti and
DR Congo after independence in early 1960s
One such individual may have been the first to bring HIV out of
sub-Saharan Africa
Conclusions
•Strong support for a single-patient introduction of
“pandemic clade” from Haiti
•In or around 1969
(long cryptic period in US)
•Ecological, not evolutionary factors determined “success”
•Do non-pandemic clade viruses have distinct
immunological properties? (Mascola et al, JID, 1994)
•Why so few successful epidemic introductions after the
pandemic clade in or around 1969?
3: When and how did HIV jump
into humans and begin its initial
spread?
Molecular archeology of
HIV: motivation
•archival sequences can provide direct tests of
evolutionary hypotheses
•1918 Spanish Flu virus has been resurrected and used to
investigate emergence, pathogenesis and other questions.
•For HIV relevant frozen samples are rare and already
screened (one from 1959, then 1976)
Nature, 1998
Science, 2000
• Ambient temperature
specimens like blood
smears and paraffinembedded tissue are
not so rare
•Between 5 and 10 microtome sections, 5-10
m in thickness
•or an approximately equivalent amount of
tissue shaved from each block with a
disposable scalpel blade
•Digestion/extraction optimzed for RNA
recovery
•Primers designed for short fragments with
primers in M-group or subtype A conserved
regions
Table S1. Primers and sequence-confirmed amplification results.
FragPrimer
Primer Sequence 5' -3'
ment #
HIVG1 (F)
a
HIVG2 (R)
Pol3290F
b
ACCCACCTATCCCAGTAGGAGAAAT
GCCAGAAAAAGACAGCTGGACTGTCAA
CCTTAGGGGARCCAAAGCTCT
env6371F
CACCACTCTATTTTGTGCATCAG
env6442R
GCATGTGTAGCCCAGACATTAT
env6445F
GTGTACCCACAGACCCCAA C
env6542R
CTCATGCATTTGTTCTACCATGT
env6828F
ACACAGGCTTGTCCAAAGGT
env6890R
ACCAGCTGGGGCACAATAAT
env7468F
CACTCCCATGCAGAATAAAACA
env7535R
AGGGGCATACATTGCTTGTC
d
CCACCAAGGCAAAGAGAAGA
env7796R
TCCCAAGAACCCAAGGAAC
env7899F
ATAGAGGCGCAACAGCATCT
env7977R
TTTCCACAGCCAGGACTCTT
env8047F
TGCCCTGGAACTCTAGTTGG
env8112R
CCATCCAGG TCATGTTCTCC
env8423F
CGAAGAAGAAGGTGGAG AGC
env8498R
GTCCCAGGCAAGTGCTAAGA
env7717F
d,e
env7805R
env7771F
d,e
CCACCAAGGCAAAGAGAAGA
GAGCTGTCTTCCTTGGGTTCT
d,e
GACGGTACAGGCCAGACAAT
1
(+)
c
(+)
(+)
(+)
2
(+)
c
(+)
(+)
(+)
3
(+)
(+)
(+)
(-)
4
(+)
(+)
(+)
(-)
5
(+)
c
(-)
(-)
(-)
6
(+)
c
(+)
(+)
(-)
7
(-)
(+)
(-)
(+)
8
(-)
(-)
(-)
(-)
9
(+)
c
(+)
(+)
(-)
10
(+)
c
(+)
(-)
(-)
11
(+)
N/D
f
N/D
N/D
12
(+)
N/D
N/D
N/D
13
(+)
N/D
N/D
N/D
14
(+)
c
N/D
N/D
N/D
CCAGACCGTGAGTTTCAACA
d,e
CTGAGGGCTATAGAGGCTCAAC
env7960R
CTTGCCTGGAGCTGTTTAATG
Previously published (S13).
a
CAN97
GCCTGTACCGTCAGCGTTA
env7937R
env7890F
BE85
TCCTGCTGCTCCTAAGAACC
env7846R
env7835F
BE81
GGTCCTTGTCTTA TGTCCAGAATGC
Pol3415R
env7717F
DRC
60
HIV DNA/RNA can be recovered from “ancient”
paraffin-embedded samples:
•
The inclusion of the 1959 and 1960 sequences appears to improve estimation
of the TMRCA of the M group.
•
Because DRC60 and ZR59 limit the influence of the coalescent tree prior on
the posterior TMRCA distributions, the different demographic models give
consistent results, with tighter date ranges and 95% HPDs that extend no later
than 1933.
•
Suggest that HIV-1 has been circulating ca. 100 years.
•
The Bayesian skyline plot tracks effective population size through time
•
Suggests that HIV-1 group M experienced a long period of relatively slow
growth in the first half of the 20th century followed by a rapid expansion
thereafter.
•
Similar pattern as observed by Yusim et al. (2001), Phil. Trans.
+
A2
A/A1
Kinshasa, 1960
B
+
D
Kinshasa, 1959
F1
F2
C
J
+
•Strict ancient DNA protocols
•Topological position (A-like, monophyletic with other DRC
sequences in a basal clade)
•Branch length
•Reproducibility
•Independent replication (blinded)
•No fragments longer than 126 nucleotides amplifiable
•RNA survived in the sample, but of quality expected for
Bouin’s-fixed specimen (B2M quantitative RT-PCR)
•Tissue of origin makes sense
•Control sequences well behaved
•The estimated age of the M
group ancestor and the
estimated time for dispersion of
the HIV-1 pandemic strains
coincide with the societal and
social changes throughout
west-Central Africa under
colonial rule.
•Historical changes in migration
and population size that
attended the founding and
rapid growth of colonial
administrative and trading
centers like Kinshasa likely
enabled the region to become
the epicenter of the HIV/AIDS
pandemic.
.
•There was no site in these
countries with a population
exceeding 10,000 until after
1910.
•Kinshasa, Brazzaville, Bangui,
and Yaoundé were founded
1881-99
•Kinshasa had 5000 inhabitants
in 1908, and 49,000 in 1940.
•It then grew to 420,000 by
1961.
Implications 1
•First putative case of HIV disease.
•Multiple, unlinked infected individuals in Kinshasa by 1960s
•Extensive genetic diversity in 1959/1960 Kinshasa (early
hub); nascent subtypes
•Opens the door to HIV “paleovirology” and comparative
evolutionary genomics
Implications 2
-Direct study of pathogenic potential of HIV and possible
changes in virulence over time
-Need for recovery of complete genomes
-Vaccine-relevant genetic change or stasis (real old
sequences in addition to computed estimates)
vaccines
•The use of a consensus or
reconstructed ancestral
sequence effectively cuts
diversity in half
•If you could create one of
these that was immunogenic,
it should have broader range
and last longer than field
isolate
•Currently, computerreconstructed consensus
strain is in trials in monkeys
•We’re working to generate
real ancestral sequences…
Fly UP