...

Horace`s duskywing (Erynnis horatius)

by user

on
Category:

forestry

2

views

Report

Comments

Transcript

Horace`s duskywing (Erynnis horatius)
Horace's duskywing (Erynnis horatius)
Si n ón i mos: Nisoniades petronius, Nisoniades virgilius
¿Tienes alguna duda, sugerencia o corrección acerca de este taxón? Envíanosla y con gusto la
atenderemos.
Foto: (c) Katja Schulz, algunos derechos reservados (CC BY)
Ver todas las fotos etiquetadas con Erynnis horatius en Banco de Imagénes »
Descripción de EOL Ver en EOL (inglés) →
Introduction 1,2
This species is widespread in the eastern U. S.
Distribution 3
occurs (regularly, as a native taxon) in multiple nations
I dnature guides 4
Identification key for butterflies of North America
Habitat 3
Commen ts : From about extreme southern New Jersey southward, almost any kind of forest, woodland,
edge or other habitat with oaks and adequate nectar for both broods, including suburban situations.
Absent or nearly so from areas such as the pristine sections of the New Jersey Pine Barrens and some
xeric southeastern pinelands that lack summer nectar. It is more restricted to xeric rocky areas and
barrens north of southern New Jersey. Oak woodlands westward.
Migration 3
N on -M i gran t : No. All populations of this species make significant seasonal migrations.
Local l y M i gran t : No. No populations of this species make local extended movements (generally less
than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).
Local l y M i gran t : No. No populations of this species make annual migrations of over 200 km.
Flowering plants visited by erynnis horatius in illinois 5
Erynnis horatius Scudder & Burgess: Hesperiidae, Lepidoptera
(observations are from Clinebell, Fothergill & Vaughn; this skipper is Horace's Duskywing)
Asteraceae: Echinacea purpurea sn (Cl), Senecio glabellus sn (FV), Taraxacum officinale sn (FV);
Fabaceae: Trifolium repens sn (FV)
Barcode data: erynnis horatius 6
The following is a representative barcode sequence, the centroid of all available sequences for this
species.
There are 3 barcode sequences available from BOLD and GenBank.
Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member
of the species.
See the BOLD taxonomy browser for more complete information about this specimen and other
sequences.
AACTTTATATTTTATTTTTGGAATTTGGGCAGGAATAGTAGGAACTTCTTTAAGTTTATTAATTCGAACTGAATTAGGTAATCCC
-- end -Download FASTA File
National nature serve conservation status 3
United States
R ou n d ed N ati on al Statu s R an k : N5 - Secure
References
1. Brower, Andrew V. Z. and Andrew Warren.2007. Erynnis horatius (Scudder & Burgess 1870).
Horace's duskywing.Version 14 May 2007 (under
construction).http://dev.tolweb.org/Erynnis_horatius/100698/2007.05.14 in The Tree of Life Web
Project, http://tolweb.org/
2. © <a href="http://tolweb.org/people/2975">Andrew Warren</a>, <a
href="http://tolweb.org/people/2589">Andrew V. Z. Brower</a>, some rights reserved
3. © NatureServe, some rights reserved
4. © Discover Life and original sources, some rights reserved
5. © John Hilty, some rights reserved
6. © Barcode of Life Data Systems, some rights reserved
Fly UP