...

Characterisation of selected populations in South Africa using genetic markers Culicoides

by user

on
Category: Documents
1

views

Report

Comments

Transcript

Characterisation of selected populations in South Africa using genetic markers Culicoides
Characterisation of selected Culicoides (Diptera: Ceratopogonidae)
populations in South Africa using genetic markers
by
Thipe Jan Debeila
Submitted in partial fulfillment of the requirements
for the degree Magister Scientiae
in the Faculty of Veterinary Science
Department of Veterinary Tropical Diseases
University of Pretoria
Supervisor: Dr. J.J.O. Koekemoer
2010
© University of Pretoria
ACKNOWLEDGEMENTS
I would like to express my sincere gratitude to the following individuals for their unique and
valuable contributions made to this study:
My supervisor, Dr. Otto Koekemoer for all the guidance, advice and support throughout
the duration of this work. His passion about the study has inspired patience and innovation
in me.
Dr. Gert Venter from Entomology section at ARC-OVI for all the support and for providing
me with a deep knowledge and expert advice on Culicoides subject.
All staff members at ARC-OVI Entomology lab for their support, especially Ms. Karien
Labuschagne for all the assistance with field collections and morphological identification of
Culicoides specimen as well as providing co-ordinates of different parts of South Africa and
Ms. Chantel De Beer who assisted with the construction of the maps.
Ms. Erika Faber and Ms. Junita Liebenberg from ARC-OVI sequencing laboratory for all
the assistance with sequencing.
Colleagues and friends on the ARC DST programme, especially Ms. Gugulethu Mkhize,
ARC-OVI Rabies lab, for showing me how to use various computer software to align and
edit DNA sequences as well as constructing phylogenetic trees.
Prof. Tony Musoke, ARC-OVI Research Institute Manager, for providing space and
resources to carry out this work.
Department of Science and Technology, South Africa, for providing funding to do this work.
Lastly, to my family for all the love and support shown during my studies.
ii
ABSTRACT
Culicoides (Diptera: Ceratopogonidae) are small (<3mm) blood feeding flies. These
flies are biological vectors of viruses, protozoa and filarial nematodes affecting
birds, humans, and other animals. Among the viruses transmitted those causing
bluetongue (BT), African horse sickness (AHS) and epizootic haemorrhagic
disease (EHD) are of major veterinary significance. Culicoides (Avaritia) imicola
Kieffer, a proven vector of both AHS and BT viruses, is the most abundant and
wide spread livestock-associated Culicoides species in South Africa. Field
isolations of virus and oral susceptibility studies, however, indicated that a second
Avaritia species, C. bolitinos Meiswinkel may be a potential vector of both BT virus
(BTV) and AHS virus (AHSV). Differences in oral susceptibility, which are under
genetic control, of populations from different geographical areas to viruses may be
an indication of genetic differences between these populations, which may be the
result of limited contact between these populations. A good knowledge of the
distribution, spread and genetic structure of the insect vector is essential in
understanding AHS or BT disease epidemiology.
In the present study, an effort was made to gather field specimens of both C.
imicola and C. bolitinos from different areas within their natural distribution in
South Africa. The aim was to partially sequence two mitochondrial genes from
these specimens and to analyse the sequence data making use of phylogenetic
trees to clarify the genetic relationships between individuals or groups collected
from geographically distinct sites. The two species were collected from four
geographically separated areas in South Africa viz. Gauteng Province, Eastern
Cape Province, Western Cape Province as well as the Free State Province. DNA
was extracted from a total of 120 individual midges of the two Culicoides species
using DNA extraction kits. Extracted DNA was analysed using PCR, sequencing as
well as phylogenetic methods.
A total of 117 mitochondrial DNA COI and 104 mitochondrial 16S ribosomal RNA
Culidoides sequences were analysed. DNA sequence polymorphism and
iii
phylogenetic relationships of various groups of C. imicola and C. bolitinos midges
were determined. The results of the phylogenetic analysis of Culicoides
populations using mitochondrial COI gene fragment showed that, at least one
subpopulation of C. imicola and two distinct genotypes of C. bolitinos species do
exist in South Africa, and further analysis is necessary. This study showed that
COI has the potential to separate Culicoides midges based on their geography.
KEY WORDS: African horse sickness, bluetongue, Culicoides, mitochondrial DNA,
sequences, cytochrome oxidase subunit I (COI), 16S rRNA, C. imicola, C. bolitinos,
South Africa
iv
TABLE OF CONTENTS
Page
TITLE PAGE
ACKNOWLEDGEMENTS
ABSTRACT
LIST OF FIGURES
LIST OF TABLES
LIST OF ABBREVIATIONS
i
ii
iii
vii
ix
xi
Chapter 1. Literature Review
1.1
Introduction
1.2
Species Classification
Geographical distribution of Culicoides
1.3
1.3.1
South Africa
Culicoides
(Avaritia) imicola Kieffier
1.3.1.1
1.3.1.2 Culicoides (Avaritia) bolitinos Meiswinkel
1.4
Disease transmission
Viral diseases associated with Culicoides species
1.4.1
1.4.1.1 African horse sickness
1.4.1.2 Bluetongue
1.4.1.3 Equine encephalosis
1.4.1.4 Epizootic hemorrhagic disease
Role of Culicoides in disease spread
1.5
Genetic analysis of Culicoides
1.6
1.6.1
Methods used in phylogenetic analysis
1.7
Problem/ Hypothesis
1.8
Aims and Objectives
1
1
2
3
3
5
6
8
8
9
9
9
10
11
14
16
16
Chapter 2. Materials and Methods
2.1
Introduction
2.2
Midge collections
2.3
Identification
2.4
DNA extractions
2.5
Polymerase Chain Reaction
2.6
Purification and sequencing of the PCR amplicons
2.7
Data analysis
17
17
19
21
21
22
22
Chapter 3. Field collections of Culicoides species at different localities
in South Africa
3.1
Introduction
24
3.2
Results
24
3.2.1
Study areas
24
3.3
Discussion
29
v
Chapter 4. Genetic analysis of Culicoides populations using mitochondrial
cytochrome oxidase I gene fragment
4.1
Introduction
31
4.2
Results
31
4.2.1
Primer selection
31
4.2.2
Midge DNA extractions and PCR amplification
32
4.2.3
Purification of the PCR product and nucleotide sequencing
33
4.2.4
Phylogenetic analysis
34
4.3
Discussion
42
Culicoides imicola
4.3.1
43
Culicoides bolitinos
4.3.2
45
4.4
Conclusion
46
Chapter 5. Phylogenetic analysis of Culicoides populations based on
mitochondrial 16S rRNA gene fragment
5.1
Introduction
5.2
Results
5.2.1
Primer selection
5.2.2
PCR and nucleotide sequencing
5.2.3
Phylogenetic analysis
5.3
Discussion
Culicoides imicola
5.3.1
Culicoides bolitinos
5.3.2
5.4
Conclusion
48
48
48
48
49
57
57
59
60
Chapter 6. General Discussions and conclusions
6.1
Intrapopulation variations
6.2
Interpopulation variations
6.3
Conclusion
6.4
Recommendations
61
63
64
65
66
Chapter 7. References
67
Appendices
82
vi
LIST OF FIGURES
Figure number
Page
1.1 Inverse distance weighing interpolated maximum catches of
Culicoides imicola, using a search radius of 200 km (Meiswinkel et al.
2004b).
4
1.2 Inverse distance weighing interpolated maximum catches of
Culicoides bolitinos, using a search radius of 200 km (Meiswinkel et
al. 2004b).
6
2.1 A 220 V ultraviolet suction light trap equipped with an 8-W black light
tube.
18
2.2 Light traps hung close to sheep on Koeberg farm at Clarens in the
19
Free State Province (Gert Venter, ARC-OVI)).
2.3 Wing patterns used in distinguishing Culicoides species (Meiswinkel
1995).
20
3.1 Map showing areas in South Africa where Culicoides imicola were
collected (Chantel De Beer, ARC-OVI).
25
3.2 Map showing areas in South Africa where Culicoides bolitinos were
collected (Chantel De Beer, ARC-OVI).
27
4.1 A 1.2% TBE agarose gel showing the COI amplification products from
C. imicola individuals from various geographical regions of South
Africa.
32
4.2 A 1.2% TBE agarose gel showing the COI amplification of C. bolitinos
individuals from various geographical regions of South Africa
33
4.3 Neighbor-joining tree constructed from alignments of 472 bp partial
nucleotide sequences of the mitochondrial DNA cytochrome oxidase
subunit I (COI) gene of two members of the Imicola Complex.
36
4.4 Phylogenetic relationships determined using partial nucleotide
sequences of the C. imicola mitochondrial DNA cytochrome oxidase I
gene fragment of individual midges.
39
vii
4.5 Phylogenetic relationships among C. bolitinos determined using
partial nucleotide sequences of the mitochondrial DNA cytochrome
oxidase I gene fragment of individual midges.
41
5.1 A 1.2% TBE agarose gel showing 16S rRNA-specific PCR products
from the individual C. imicola and C. bolitinos from various regions of
South Africa.
49
5.2 Phylogenetic relationships among the two members of the Imicola
Complex analysed using mitochondrial 16S rRNA gene fragments.
52
5.3 Phylogenetic relationships of the Culicoides imicola based on
mitochondrial 16S rRNA gene fragments of individual midges from
different localities.
54
5.4 Phylogenetic relationships among Culicoides bolitinos from
different regions of South Africa.
56
viii
LIST OF TABLES
Table number
Page
3.1
Culicoides abundance and Culicoides imicola representation
as determined with light traps at the collection sites where C.
imicola were collected for phylogenetic analysis.
26
3.2
Culicoides abundance and Culicoides bolitinos
representation as determined with light traps at the collection
sites where C. bolitinos were collected for phylogenetic
analysis.
28
4.1
Cytochrome Oxidase I primers, size of amplicon and their
nucleotide sequences.
32
4.2
Details of the Genbank sequences included in the
phylogenetic analysis.
34
4.3
Explanations of the symbols used on the phylogenetic trees.
35
4.4
The 14 COI haplotypes for C. imicola populations from
different geographic areas.
37
4.5
The COI diversity of C. imicola populations from different
geographic areas.
38
4.6
The 11 COI haplotypes for C. bolitinos populations from
different geographic areas.
40
4.7
The COI diversity of C. bolitinos from different geographic
areas.
40
5.1
16S rRNA primers, sizes and their nucleotide sequences.
48
5.2
Culicoides GenBank
investigation.
this
51
5.3
Comparison of twenty one 16S rRNA haplotypes for C.
imicola populations from different geographical areas
generated using DnaSP.
53
5.4
Statistical values used to estimate the 16S rRNA diversity of
C. imicola from different geographic areas in South Africa.
53
sequences
ix
included
in
5.5
Comparison of the nineteen 16S rRNA haplotypes for C.
bolitinos populations from different geographical areas
generated using DnaSP.
55
5.6
Statistical values used to estimate 16S rRNA diversity of C.
bolitinos from different geographic areas in South Africa.
55
x
LIST OF ABBREVIATIONS
AHS
African horse sickness
AHSV
African horse sickness virus
bp
base pair
BT
Bluetongue
BTV
Bluetongue virus
COI
Cytochrome Oxidase subunit I
COII
Cytochrome Oxidase subunit II
ºC
degree Celsius
DNA
Deoxyribonucleic acid
DnaSP DNA Sequence Polymorphism
dNTP
deoxynucleoside triphosphate
dsRNA double stranded Ribonucleic acid
EDTA
Ethylene di-amine-tetra-acetate
EE
Equine encephalosis
EEV
Equine encephalosis virus
EHD
Epizootic hemorrhagic disease
EHDV
Epizootic hemorrhagic disease virus
Fig
figure
g
gram
Hd
haplotype diversity
ITSI
Internal transcribed spacer I
ITS2
Internal transcribed spacer 2
km
kilometre
µg
microgram
µl
microlitre
µM
micromolar
ml
millilitre
mm
millimetre
xi
mM
millimolar
mtDNA mitochondrial DNA
MEGA
Molecular Evolutionary Genetic Analysis
ng
nanogram
Pi
nucleotide diversity
OIE
Office International des epizooties
OVI
Onderstepoort Veterinary Institute
pmol
picomole
PCR
Polymerase Chain Reaction
RAPD
Random Amplified Polymorphic DNA marker
rRNA
Ribosomal Ribonucleic acid
s
seconds
ss
senso stricto
SSCP
single stranded conformation polymorphism
SA
South Africa
sp
species
SD
standard deviations
TBE
Tris-Borate-EDTA
TE
Tris-EDTA
UV
ultraviolet
U
unit
V
Volt
v
volume
W
Watt
W/V
Weight per Volume
16S
16 subunit
xii
CHAPTER 1
LITERATURE REVIEW
1.1 INTRODUCTION
Culicoides biting midges are small blood feeding flies 1 to 3 mm in size (reviewed
by Meiswinkel et al. 2004a) which play an important role as vectors of several
disease agents such as nematodes, protozoa and viruses (Linley 1985;
Meiswinkel et al. 2004a). Culicoides females feed on a broad spectrum of hosts
including reptiles, mammals, birds, man (Meiswinkel et al. 2004a) and will even
feed on blood-engorged mosquitoes (Wirth & Hubert 1989). They are regarded
as pests of great veterinary importance (Ludivik et al. 2005). Bites from some
species of Culicoides can cause summer seasonal recurrent dermatitis referred
to as sweet-itch (Braverman 1988). Orbiviruses are the most important
pathogens vectored by Culicoides species.
Genetic analysis has become a vital tool in vector and vector borne disease
research. It can help to clarify the taxonomy of vectors including systematics and
classification. It can assist in phylogenetics and population genetic studies as
well as determining the geographical distribution and dispersal of midge species.
Defining the genetic differences and similarities between vectors species and
populations will help to clarify vector dispersal which might be linked to viral
spread, vector capacity and vector competence. A good knowledge of the latter
can make the combat of the diseases spread by Culicoides vectors more
efficient.
1.2 Species Classification
The genus Culicoides belongs to the Ceratopogonidae family within the Order
Diptera. Worldwide there are more than 1 400 described Culicoides species
grouped into at least 38 subgenera (Borkent & Wirth 1997). The most important
vectors are found within the Culicoides Imicola complex of the subgenus Avaritia
1
Fox, 1955 which comprises of at least 13 species of which four are yet
undescribed. The nine described species are Culicoides imicola ss (senso
stricto)
Kieffer
1913,
Culicoides
brevitarsis
Kieffer
1917,
Culicoides
pseudopallidepennis Clastier 1958, Culicoides nudipalpis Delfinado 1961,
Culicoides bolitinos Meiswinkel 1989, Culicoides miombo Meiswinkel 1991,
Culicoides loxodontis Meiswinkel 1992, Culicoides sp.# 107 (= C. kwagga,
Meiswinkel, unpublished thesis 1995), and Culicoides tuttifrutti Meiswinkel,
Cornet and Dyce 2003.
1.3 Geographical distribution of Culicoides
Culicoides midges have a worldwide distribution and are found in all countries on
every continent except Antarctica, New Zealand and Hawaii (Mellor et al. 2000).
Specific species have been identified as dominant vectors in broad geographical
regions of the world: In southern Europe Culicoides (Avaritia) obsoletus Meigen
and C. imicola, northern Europe C. obsoletus, North America Culicoides
(Monoculicoides) sonorensis Wirth & Jones, South America Culicoides
(Hoffmania) insignis Lutz, Australia Culicoides (Avaritia) wadai Kitaoka and
Culicoides (Avaritia) brevitarsis Kieffer, and the most widely distributed species in
Africa is C. imicola (Tabachnick 2004).
Apart from being widespread in Africa, C. imicola is also present in the Near,
Middle and Far East as far as southern China, Laos and Vietnam (Meiswinkel
1989; Meiswinkel et al. 2004a). Although morphological studies have identified C.
imicola from Italy, Spain, Portugal, Israel and South Africa as being a single
species (Meiswinkel 1989; Meiswinkel & Baylis 1998), it has been shown that C.
imicola populations from different geographic locations could be distinguished
genetically (Nolan et al. 2004). A subdivision was observed between C. imicola
populations from the western and eastern Mediterranean using COI sequences
(Nolan et al. 2008).
2
1.3.1 South Africa
Of the more than 112 Culicoides species identified in South Africa over the past
35 years (Meiswinkel et al. 2004b), C. imicola is the only proven vector of the
viruses that cause AHS and BT. Nevill (1971) has shown that C. imicola was the
most abundant livestock associated species in the Onderstepoort area.
Subsequent light trap surveys confirmed C. imicola to be the most abundant
livestock-associated Culicoides species in the summer rainfall areas, especially
in the warm frost-free areas of the country (Meiswinkel 1989; Venter et al. 1996).
It was also dominant in the winter rainfall areas of the country (Venter et al.
2006b). Culicoides imicola cannot be regarded as the only vector of orbiviruses
because it is relatively uncommon in warm/dry and cool/wet areas (Venter 1991;
Venter et al 1996). Members of the Culicoides (Remia) schultzei group and
Culicoides (Hoffmania) zuluensis de Meillon were the most abundant species in
the latter areas (Venter 1991; Venter et al. 1996). Some of the abundant and
widely distributed Culicoides species might be of less importance as potential
vectors of livestock viruses due to their host preference for birds and/or restricted
breeding site preferences (Nevill et al. 1992). Although the genetic relationships
between populations of single species from different parts of the world were
established (Nolan et al. 2004; Nolan et al. 2008), the genetic relationship
between midges of the same species from different geographic localities within a
single country is not known. Culicoides imicola and C. bolitinos are the most
widespread and abundant members of the Imicola complex in South Africa.
1.3.1.1 Culicoides (Avaritia) imicola Kieffier, 1913
In South Africa C. imicola is the only member of the Imicola complex which was
successfully used in transmission of an orbivirus (Du Toit 1944; Wetzel 1970)
and is therefore the only proven vector of orbiviruses in the country. Culicoides
imicola can be found in low numbers in the cooler regions of the country (Baylis
et al. 1998; Meiswinkel et al. 2004b) (Fig. 1.1). Culicoides imicola can be
extremely variable in prevalence and abundance ranging from being totally
absent (Meiswinkel 1997) to being widespread and super abundant in the vicinity
3
of livestock (Meiswinkel 1998) (Fig. 1.1). As an abundant and important vector
species, its distribution has been well studied (Venter et al. 1996; Baylis et al.
1998;1999; Meiswinkel et al. 2004b). The distribution and abundance of C.
imicola is affected by climatic factors such as temperature, aridity, topographic
slope (inducing water run-off), soil type (slow or rapid drainage) and soil fertility
(presence of specific microorganisms) (Baylis et al. 1998; 1999).
Interpolated
maximum catch
50 000
5 000
500
50
5
0
Figure 1.1: Inverse distance weighing interpolated maximum catches of
Culicoides imicola, using a search radius of 200 km. The results are based on
weekly light trap collections made at 40 sites from September 1996 to August
1998 (Meiswinkel et al. 2004b)
4
1.3.1.2 Culicoides (Avaritia) bolitinos Meiswinkel, 1989
Another species of the Imicola Complex, C. bolitinos, has emerged in the last
decade as a potential vector of bluetongue virus (BTV) and African horse
sickness virus (AHSV) in South Africa, especially in higher-lying parts where
cooler conditions prevail and C. imicola are less abundant (Meiswinkel &
Paweska 2003). Its role as a field vector is supported by laboratory oral
susceptibility studies (Venter et al. 1998; Venter et al. 2000). However, it is not
yet proven that it can transmit any virus.
Culicoides bolitinos was described in 1989 after it was initially confused with both
C. imicola and C. brevitarsis (Meiswinkel 1989). It was only distinguished from C.
imicola after it was found to breed in African buffalo (Syncerus caffer) dung in the
Kruger National Park in South Africa (Meiswinkel & Dyce 1989). Culicoides
bolitinos is restricted to the tropical and subtropical regions of Africa south of the
Sahara desert. This includes South Africa, Botswana, Zimbabwe, Lesotho,
Malawi, Kenya, Nigeria, the Ivory Coast, Gambia, Madagascar and Mauritius
(Meiswinkel 1989; Meiswinkel et al. 2004a). It is widespread in South Africa and
has been found in most areas where C. imicola occurs (Meiswinkel et al. 2004a)
(Fig. 1.2). It is believed that C. bolitinos will concentrate in areas where there are
bovines as its main breeding site is bovine dung. Its prevalence and seasonal
abundance has only been studied in South Africa (Meiswinkel 1989) and it was
determined that C. bolitinos is about 10 times less abundant than C. imicola (Figs
1.2 & 1.3). Due to its wide temperature stable breeding habitat, bovine dung, it
can be more abundant than C. imicola in the cooler parts of the country
(Meiswinkel et al. 2004b).
5
Interpolated
maximum catch
50 000
5 000
500
50
5
0
Figure 1.2: Inverse distance weighing interpolated maximum catches of
Culicoides bolitinos, using a search radius of 200 km. The results are based on
weekly light trap collections made at 40 sites from September 1996 to August
1998 (Meiswinkel et al. 2004b)
1.4 Disease transmission
Of the more than 1 400 described Culicoides species, about 96% are obligatory
blood feeders on mammals and birds (Meiswinkel et al. 2004a). Fewer than 50 of
these species are involved in disease transmission and less than 10 are proven
vectors of viruses (Mellor et al. 2000; Meiswinkel et al. 2004a). More than 75
viruses were isolated from Culicoides worldwide and 23 are from species of the
Imicola complex of the subgenus Avaritia (Meiswinkel et al. 2004a). The
geographical distribution and seasonal incidence of the disease causing viruses
6
are partly determined by the distribution and the biology of competent Culicoides
vectors.
The ability of a vector to successfully transmit a disease depends on factors such
as vector competence and vector capacity. Vector competence is defined as a
measure of the number of midges that become infective and successfully
transmit a virus after feeding on a viraemic host and is dependant upon the
genetic makeup of the vector and external environmental influences (Tabachnick
1991; Wellby et al. 1996; Wittmann et al. 2001). The vector capacity of a species
can be expressed by the average number of infective bites that will be delivered
by a vector feeding on a single host in one day (Dye 1992). Low biting rates
and/or survivorship can render a highly competent vector to have a low vectorial
capacity and more efficient virus transmission may occur in a more abundant
vector with low competence status. The Australian species C. brevitarsis has a
low competence for BTV, but could transmit the virus effectively due to its high
biting rate, whereas, due to lower abundance and limited geographical
distribution, the more competent C. fulvus has a lower vectorial capacity
(Standfast et al. 1985).
It was demonstrated through a series of studies that C. bolitinos is highly
susceptible to infection with BTV, and has the ability to replicate strains to higher
virus titres more than C. imicola (Venter et al., 1998, 2004, 2006a, 2007). In
addition it was found that C. bolitinos can replicate BTV serotype 1 to higher
levels than C. imicola at lower temperatures over shorter incubation periods
(Paweska et al. 2002). Oral susceptibility studies for C. imicola populations from
Clarens, Stellenbosch and Onderstepoort revealed significant differences in the
vector competence of Clarens and Onderstepoort populations for specific
isolates of AHSV2 and AHSV9 (Venter et al, 2009). This suggests that
genetically distinct populations of C. imicola may be present in South Africa.
7
Viruses isolated from field collected C. imicola include BTV, AHSV, EHDV and
EEV (Nevill, et al. 1992; Meiswinkel et al. 2004a). Oral susceptibility studies have
shown that BTV, EHDV, AHSV and EEV can infect and replicate in this species
(Venter et al. 1999; 2002; Paweska & Venter 2004). The role of C. bolitinos as a
potential vector of BTV and AHSV is highlighted by the fact that isolates of both
viruses were made from field collected midges (Meiswinkel & Paweska 1998).
Viruses isolated from field collected C. bolitinos include BTV, AHSV and EEV
(Nevill, et al. 1992; Meiswinkel et al. 2004a).
The relationship between the virus, the insect vector, the vertebrate host, and the
environmental conditions determines whether the successful transmission of the
virus from an infected to a susceptible host will occur or not (Hardy et al. 1983).
1.4.1 Viral diseases associated with Culicoides species
Of the 75 arboviruses isolated from Culicoides species worldwide, most belong to
the Bunyaviridae (20), Reoviridae (19) and Rabdoviridae (11) families (Mellor et
al. 2000; Meiswinkel et al. 2004b). The AHSV, BTV, EEV and EHDV are the
most well known viruses that cause the diseases AHS, BT, EE and EHD
respectively.
1.4.1.1 African horse sickness
African horse sickness is an infectious, non contagious disease that affects
equids. AHS disease remains essentially African but incursions have occurred
into Saudi Arabia, Portugal and Spain (Howell 1963; Mellor et al. 1990). The
disease is enzootic in sub-Saharan Africa and it has a mortality rate of more than
90% in susceptible horses (Maurer & McCully 1963; Coetzer & Erasmus 1994).
8
1.4.1.2 Bluetongue
Bluetongue is an infectious viral disease that affects sheep and other ruminants.
It is characterized by inflammation, haemorrhage, excoriations and erosion,
coronitis, torticollis, oedema of the head and neck and cyanosis of the mucous
membranes of the oronasal cavity (Verwoerd & Erasmus 2004). Bluetongue is of
such international significance that it has been classified as a notifiable disease
by the OIE.
1.4.1.3 Equine encephalosis
Equine encephalosis is an infectious, non-contagious, disease of Equidae. The
etiological agent, EEV, belongs to the genus Orbivirus (Calisher & Mertens 1998)
and it was isolated in 1967 from horses in South Africa (Erasmus et al. 1970;
1978). EEV has only been isolated in southern Africa and no vaccine is available
against this disease. While high seroprevalence in horse and donkey populations
were reported in South Africa (Paweska et al. 1999; Venter et al. 1999) only
sporadic cases or localised disease outbreaks occurred in the country. It does
indicate that EEV infections are mostly asymptomatic. The involvement of
Culicoides species in the epidemiology of EEV in the field (Erasmus et al. 1970;
Theodoridis et al. 1979, Nevill et al. 1992) were confirmed when it was shown
that C. imicola and C. bolitinos are susceptible to infection by this virus (Venter et
al. 1999; 2002; Paweska & Venter 2004).
1.4.1.4 Epizootic hemorrhagic disease
Epizootic hemorrhagic disease is an often-fatal hemorrhagic disease in North
American white-tailed deer (Odocoileus virginianus) with bluetongue-like
symptoms in cattle and subclinical infections in domestic sheep (Pasick et al.
2001). In South Africa, evidence shows that EHDV can be dated back to 1932
(Bekker et al. 1934, Barnard et al. 1998). The involvement of Culicoides species
in the epidemiology of EHD in South Africa has been demonstrated by the
isolation of EHDV from field collected Culicoides species (Nevill, et al. 1992).
9
1.5 Role of Culicoides in disease spread
Vector dispersal and the rate of dispersal of infected vectors can play a critical
role in the spread of a disease and the implementation of effective control
measures. The dispersal of Culicoides midges can be influenced by factors such
as temperature, wind speed, wind direction, distance to be travelled from
endemic areas, increasing altitude, urban areas and mountain ranges acting as
physical barriers (Bishop et al. 2004).
Very little is known about the dispersal of C. imicola. It is believed that Culicoides
species can be transported for hundreds of kilometres by prevailing winds
(Sellers et al. 1977; Mellor et al. 2000) and inadvertently through the
transportation of livestock (Meiswinkel 1998). It cannot be explained whether the
presence of C. imicola on the islands off the African east and west coast such as
Madagascar, Reunion, Mauritius and the Cape Verde resulted from wind
transport or whether it was transported simultaneously with the livestock
(Meiswinkel 1995). The dispersal of C. bolitinos is similar to that of C. imicola, but
C. bolitinos is closely associated with African buffalo and can disperse, over
relative short distances, with slow moving herds (Meiswinkel 1995).
In Europe, BT has expanded northwards between 1998 and 2004 with outbreaks
of the disease over 800 km further north than had previously been recorded in
southern Europe (Purse et al. 2005). Expansion of C. imicola northwards into the
southern Europe has been ascribed to the recent climate change (Wittmann et al.
2001; Purse et al. 2005). Outbreaks of BTV serotype 8, in the absence of C.
imicola, have been confirmed as far north as the Netherlands, Belgium, Germany
and northern France in September 2006 (OIE 2006; Thiry et al. 2006).
In South Africa, it has been postulated that the transportation of viraemic horses
from endemic areas lead to outbreaks of AHS in the Western Cape Province
(Bosman et al. 1995; Bell 1999; Guthrie 1999). In addition to the movement of
viraemic hosts, the occurrence of AHS in the Eastern and the Western Cape
10
Provinces over the past 5-10 years could be attributed to the movement or
dispersal of infected vectors. However, the region in the middle of the country is
dry and it is believed to create a barrier that prevents C. imicola from the north
(e.g. Onderstepoort) to interbreed with the population from the south (i.e.
Western and Eastern Cape Provinces). If infected vectors are transported, by
any method, it follows that this might be a possible mechanism for the
introduction of disease into new areas. The identification and genetic
characterization of Culicoides populations in South Africa may help to predict
outbreaks and explain the epidemiology of AHSV and BTV in the country.
1.6 Genetic analysis of Culicoides
Mitochondrial genes are often targeted for genetic analysis of insects because
they evolve faster than nuclear genes (Watanabe et al. 1999). They are ideal for
measuring genetic variations because: they are abundant in cells, can easily be
amplified by PCR using conserved primer sets, are maternally inherited and have
specific regions that are highly variable (Simon et al. 1994). The cytochrome
oxidase I (COI) and 16S ribosomal RNA genes are the most commonly used
mitochondrial sequences in genetic analysis of insect vectors (Shouche & Patole
2000; Linton et al. 2002). They have several advantages which include high
resolution in distinguishing between species of the same and different genera as
well as revealing subpopulations in certain species (Shouche & Patole 2000,
Dallas et al. 2003; Ouma et al. 2005). These two mitochondrial sequences were
used in the current study for the genetic analysis of midges from different
locations in South Africa.
The COI gene is one of the fastest evolving mitochondrial genes that have often
been used in insect genetic studies. An example was the use of mitochondrial
COI and cytochrome oxidase II (COII) genes in Papilio butterflies phylogenetics
to examine patterns of gene evolution across a broad taxonomic range of these
taxa (Caterino & Sperlings 1999). Their results have shown that COI had an
excellent performance, in resolving Papilionidae relationships at species and
11
species group level (Caterino & Sperlings 1999). Similarly, COI sequences could
successfully distinguish between the east and the west population of C. imicola in
the Mediterranean basin (Dallas et al. 2003; Nolan et al. 2008). The COI primer
sequences as described by Dallas et al. (2003) were used in this study for the
analysis of the South African populations of C. imicola and C. bolitinos.
The present study will provide a basis for midge genetic analysis of
geographically closer and separated populations of the same species from the
same country. Several studies have been done to characterise different
Culicoides species and midges of the same species from different countries (i.e.
geographically well separated study areas), but very little on individuals of a
single species from one country (i.e. relative close geographic locations). For
example, mitochondrial COI sequences were successfully used to distinguish
between five species of the C. imicola complex (Linton et al. 2002). Their results
suggested that BTV vector competence could be an ancestral character in this
complex. Furthermore, C. imicola populations from Portugal, Rhodes and Israel
were analyzed using COI sequences to determine their matrilineal structure and
to phylogenetically characterize them, and its reliability has been shown by the
ability to differentiate between the western and the eastern populations (Dallas et
al. 2003). Analyses of the haplotype diversity of the mitochondrial COI gene in C.
imicola from 88 sites in the Mediterranean and outgroups showed extreme
differentiation across the Mediterranean basin, with four common haplotypes
each predominating in different areas. Eastern and western areas characterized
by distinct BTV incursions accounted for most of the molecular variance in
haplotype composition (Nolan et al. 2008).
Mitochondrial ribosomal genes can also be effectively used for genetic studies of
insects. Ribosomal genes have been extensively used for phylogenetic studies in
a wide range of species due to their universal occurrence, abundance, as well as
sequence
and
structural
conservation
(Hamby
&
Zimmer
1992).
The
mitochondrial rRNA genes are less complex than the nuclear rRNA genes which
12
have about five different subunits that might be duplicated as tandem arrays,
separated by transcribed and non transcribed spacer regions (Brown et al. 1979;
1982; Watanabe et al. 1999). The rate of evolution of ribosomal RNA genes is
known to vary with the length of the molecule and its sequences have been
widely used for phylogenetic studies and for determination of sequence
differences that reflect strain variation in hypervariable regions (Shouche &
Patole 2000).
Sequences of the mitochondrial 16S rRNA gene have been used to study black
flies, mosquitoes as well as midge species, and this gene has proven to be a
useful tool to construct insect phylogenies (Xiang & Kochar 1991; Shouche &
Patole 2000; Ouma et al. 2005). The diversity of this molecule has allowed a
comparative analysis of eubacterial, archaebacterial and eukaryotic kingdoms,
chloroplasts as well as mitochondria (Noller et al.1985). Due to its potential as a
phylogenetic marker, it became important that this gene be considered for use in
the current Culicoides study.
Very little is known about the population structures of Culicoides species in South
Africa, taking into account the size, geographical diversity and the presence of
potential natural barriers. The geographical distribution of C. imicola and C.
bolitinos is well known in South Africa. What is not clear is if these populations
are dispersed homogenously throughout South Africa or if they are static with
limited gene flow between different geographically isolated populations. If
populations can indirectly be shown to be isolated, dispersal of the virus over
large distances through insect dispersal is unlikely. On the other hand, if the
genetic analysis shows that there is a high level of inbreeding between these
populations it might be possible that viruses may be transmitted along with
individual dispersing insects.
However, due to the presence of natural barriers which range from semi desert
areas and mountain ranges, it is believed that subpopulations of midges might
13
have become established over time in South Africa with the biggest possibility of
a north-south split. This notion is supported by oral susceptibility studies
indicating that the susceptibility of different geographical populations of C. imicola
and C. bolitinos may differ for identical isolates of AHSV (Venter et al. 2009).
Furthermore a study done using random amplified polymorphic DNA (RAPD)
markers has indicated that some bands are population specific as observed on
the agarose gel, with C. imicola populations from Onderstepoort and Skukuza
distinguished from Tshipise, Phalaborwa and Mtunzini populations (Sebastiani et
al. 2001). Microsatellites genes can be helpful in the genetic characterisation of
midges, however, more markers need to be developed for Culicoides species to
the extent that it can provide meaningful data.
1.6.1 Methods used in phylogenetic analysis
DNA sequence assembly is the first essential step in phylogenetic analysis which
combines the two DNA sequences generated from the same DNA sample using
the reverse and forward primers. The forward and the reverse sequences are
assembled together to generate the consensus sequence. The Gap4 Staden
software package is the preferred and easy to use method for this purpose due
to its ability to handle sequence data produced by variety of sequence
instruments and can handle data entered using digitiser or typed by hand
(Bonfield & Staden 1995).
Consensus sequences generated using the Gap4 are used for multiple sequence
alignment process. The process aligns the most closely related sequences first
and groups them together. Software packages that are being used to perform
multiple sequence alignments include T-Coffe, MAFFT, DNAMan, Clustal X,
e.t.c. Clustal X is a widely used and preferred method due to its ability to provide
integrated system for performing multiple sequence alignment, profile alignment
and it allows one to view results by providing algorithms to refine and improve the
alignment. The multiple sequence alignment generated using Clustal X can also
14
be transferred to BioEdit software as an additional tool to help with the editing
process of the sequences. BioEdit can be defined as a mouse-driven, easy-touse sequence alignment editor and sequence analysis program with four modes
of manual alignment such as select and slide, grab and drag, gap insert and
delete by mouse click with on screen typing that behaves like a text editor (Hall
1999). This method allows for the trimming of the sequence terminals to generate
a desired sequence length. The edited sequences are then transferred back to
Clustal X for re-alignment. Clustal X then converts aligned multiple sequences to
a PHB file that could be opened using Neighbor-joining (NJ Plot) method for
phylogenetic tree construction. NJ method is widely used for the construction of
the phylogenetic trees due to its high computational speed and its ability to
incorporate large amount of data. NJ method produces phylogenetic trees where
the sum of the number of mutations along evolutionary path for each taxon within
the cluster is represented by the distance since their divergence is from common
ancestory (Saitou & Nei 1987).
15
1.7 Problem/ Hypothesis
Very little is known about the genetic variation within Culicoides species and no
particular genetic markers have been identified for use in intra-species analyses.
Due to geographical separation of midge populations in the southern and
northern regions of the country, together with phenotypic variations that have
been observed, it is hypothesized that genetic differentiations do exist within
Culicoides species in South Africa. Can COI and 16S rRNA nucleotide
sequences that have been used previously be used to distinguish between
closely related species or specimens from different countries also be used with
success to indicate genetic variations within C. imicola and C. bolitinos in South
Africa?
1.8 Aims and Objectives
The aim is to identify suitable genetic markers that can reveal genetic variation
between geographically separated populations of C. imicola and C. bolitinos, if
they exist.
The specific objectives are to:
1. Gather field specimens of both C. imicola and C. bolitinos from different areas
within their natural distribution in South Africa.
2. Partially sequence two mitochondrial genes from these specimens.
3. Analyse the sequence data and make use of phylogenetic trees to clarify the
genetic
relationships
between
individuals
geographically distinct sites.
16
or
groups
collected
from
CHAPTER 2
MATERIALS AND METHODS
2.1 INTRODUCTION
All the materials and methods that were used to carry out the experimental work
described in Chapters 3, 4 and 5 are described in this chapter. Any diversions in
subsequent chapters will be noted where applicable.
2.2 Midge collections
Onderstepoort 220 V ultraviolet downdraught suction light traps equipped with a
23 cm 8 W black light tube (Fig. 2.1) were used to collect midges at each site.
Traps were hung close to livestock and operated from dusk to dawn (Fig. 2.3).
Insects were collected into 200-300 ml of a 1% v/v water solution of Savlon®
(Johnson and Johnson, South Africa) (containing Chlorhexidine gluconate 0.3
g/100 ml and Cetrimide 3.0 g/100 ml). Savlon breaks the surface tension of the
water so that the insects sink to the bottom of the beaker and also prevents
bacterial growth which can cause rotting of the insects. The removal of insects
from the traps was done in the morning, and the insects were taken to the
laboratory for morphological identification of species.
17
Figure 2.1: A 220 V ultraviolet suction light trap equipped with an 8 W black light
tube
18
Figure 2.2: Light traps hung close to sheep on Koeberg farm at Clarens in the
Free State Province
2.3 Identification
Light traps are non-specific and collect a variety of night flying insect species that
are small enough to go through the surrounding gauze (mesh size 2-3 mm).
Upon arrival in the laboratory, the contents of the beaker was washed by filtering
it through fine netting and rinsed gently three or four times with distilled water.
Rinsing cleans the midges from any extraneous moth-scales that may adhere to
the wings as this can make identification difficult once preserved in alcohol
(Meiswinkel 1995). A key to the adults of nine of the 13 species of the Imicola
complex is provided by Meiswinkel (1995; 2003).
Identification of the C. imicola and C. bolitinos was done under a dissecting
microscope using wing morphology (Fig. 2.3) as described by Meiswinkel (1995).
Ten character states are used for morphological identification in Culicoides
species. Culicoides imicola can be distinguished from C. bolitinos using the
19
single most diagnostic character called the preapical excision, which is the
juxtaposition of pale and dark areas on the anterior distal third of vein M2. The
diagnostic features of the female C. imicola are only based on patterns of the
wings, whereas C. bolitinos is identified based on the median third of both the
posterior and anterior margins of vein M2 that has extreme darkness. These
margins taper and fade simultaneously as they leave the apex of the vein (Fig.
2.3) (Meiswinkel 1989).
M1
M2
A – Culicoides imicola
M2
B – Culicoides bolitinos
Figure 2.3: A – B, Wing patterns used in distinguishing Culicoides species
(Meiswinkel 1995)
The two species were stored separately in 1.5 ml epperndorf tubes in 80%
ethanol. The tubes were labelled with species name, collection date and site.
Individual midges were used for molecular analysis. Only nulliparous females
and males were used for DNA extraction. Midges were either used immediately
after trapping or stored at -20˚C. Parous midges were not considered for DNA
extraction as the host DNA might contain similar targeted mitochondrial genome
that could be amplified together with midge DNA due to the universal nature of
the primers. Nulliparous and parous midges were separated based on the
presence or absence of pigment in the abdomen following the methods
described by Dyce (1969).
20
M1
2.4 DNA extractions
Total genomic DNA was extracted from individual midges using the QIAamp
DNA Micro kit (QIAgen, Germany) and NucleoSpin tissue kit (Macherey-Nagel,
Germany). Individual midges were homogenized in a 1.5 ml microcentrifuge tube
containing the lysis buffer. The manufacturer‘s instructions for the isolation of
genomic DNA from tissues were followed with slight modification (i.e. midges
were homogenized using a battery operated microtissue grinder (Kontes,
Vinelan, NY) and micro-pestle in a lysis buffer before the addition of proteinase
K). DNA was eluted in 30-60 µl of elution buffer and stored at -20ºC for
subsequent amplification reactions.
2.5 Polymerase Chain Reaction (PCR)
DNA amplification was carried out in a programmable thermocycler (GeneAmp
PCR System 2700, Applied Biosystems). The PCR reaction mixtures were
performed in a total volume of 50 µl which contained 5 µl of 10 X PCR buffer, 4 µl
of 2.5 mM dNTP mixture, 10 pmol of each of the forward and the reverse
primers, 5 U of Ex-Taq DNA polymerase (Takara) and 34.5 µl of distilled water. A
volume of 5 µl DNA was added to each PCR reaction. Samples without DNA
were included in each amplification to check for contaminations. Two sets of
primers (i.e. cytochrome oxidase I (COI) and 16S rRNA primer sets) were used
separately with the same PCR parameters. Thermal cycling conditions were as
follows: denaturation at 94ºC for 2 minutes, followed by 94ºC for 30s, annealing
at 55ºC for 30s and extension at 72ºC for 30s, for 40 cycles followed by final
extension at 72ºC for 4 minutes.
The success of the DNA amplification was determined by loading an aliquot (4 µl)
of the PCR product mixed with 1 µl loading dye (0.25% bromophenol blue; 40%
sucrose) on a 1.2% (W/V) agarose gel containing 0.25 µg/ml ethidium bromide in
1 x Tris-borate EDTA (TBE) buffer. A 50 bp DNA molecular ladder (Roche
Diagnostic,
Germany)
was
loaded
alongside
21
the
PCR
samples
and
electrophoresed at 90 V for 45 minutes. Amplified DNA was visualized using UV
fluorescence and the size of the product was verified.
2.6 Purification and sequencing of the PCR amplicons
PCR products were purified using the QIAquick PCR purification kit (QIAgen,
Germany) or a MSB Spin PCRapace kit (Invitek, Germany). A 250 µl binding
buffer was added to the PCR sample and vortexed for 1 minute. The sample was
completely transferred onto a spin filter and centrifuged for 3 minutes at 12.000
rpm. The DNA was eluted in 50 µl of the elution buffer. The purified DNA was
quantified using spectrophotometer and loaded alongside 50 bp DNA ladder on
1.2% ethidium bromide stained agarose gel prior to nucleotide sequencing.
Approximately 5-20 ng of the purified PCR product was sequenced using the
same forward and the reverse primers that were used for the PCR amplification.
2.7 Data analysis
Nucleotide sequences obtained from the sequencing laboratory were edited by
assembling together the forward and the reverse sequences of each individual
midge using Gap4 of the Staden software package (Bonfield et al. 1995) to
generate a consensus sequence. Multiple alignments of the consensus
sequences were performed using Clustal X (Higgins & Sharp 1989; Higgins
2003). Editing of the multiple alignments was done using BioEdit and the
sequence terminals of the consensus sequences were trimmed at each end to
produce sequences with a length of 472 bp and 450 bp for COI and 16S rRNA
respectively. The data generated from Clustal X was used to construct distance
matrices for the phylogenetic trees using the Neighbor-joining method (Saitou &
Nei 1987). The sequences were also imported for construction of the
phylogenetic trees into Mega 4.0 (Tamura et al. 2007). The significance of the
branching pattern was evaluated using 1 000 replicates with bootstrap statistical
support values. Values of 70% or bigger were regarded as evidence that the
groupings are true reflection of the real relationship (Hillis & Bull 1993). The
sequence data was then imported for further analysis into DNA sequence
22
polymorphism (DnaSP) software package to determine DNA polymorphism
(Rozas et al. 2003).
23
CHAPTER 3
FIELD
COLLECTIONS
OF
CULICOIDES
SPECIES
AT
DIFFERENT
LOCALITIES IN SOUTH AFRICA
3.1 INTRODUCTION
Midges from geographically separated location in South Africa were collected using
220 V light traps as described in Chapter 2. Midges were identified to species level
based on wing morphology and DNA was extracted as described in Section 2.3 and
2.4. The extracted DNA was used for the analysis described in Chapter 4 and 5.
3.2 RESULTS
3.2.1 Study areas
Culicoides imicola were collected from three geographically separated areas in
South Africa viz. Gauteng Province (Onderstepoort, Pretoria), Eastern Cape
Province
(Kirkwood,
Port
Elizabeth) and
the Western
Cape
Province
(Stellenbosch, Cape Town). As reflected in Fig. 3.1 and Table 3.1, midges were
collected at more than one site within each of these broad geographical areas.
Stellenbosch is situated 1 500 km southwest of Onderstepoort and is a winter
rainfall area. Winters at Onderstepoort and Stellenbosch are relatively frost-free.
The names of the farms where midges were collected are given in Table 3.1.
24
Figure 3.1: Map showing areas in South Africa where Culicoides imicola were
collected (Chantel De Beer, ARC-OVI). Light trap collection sites are represented
by blue triangles inside the red circles.
25
Table 3.1 Culicoides abundance and Culicoides imicola representation as
determined with light traps at the collection sites where C. imicola were collected
for phylogenetic analysis (unpublished data Venter & Labuschagne, ARC-OVI)
Sample Name
Locality
Farm (No. of light
trap collections)
Collection date
Average No. of
Culicoides
collected/night
Gauteng Province
iOPV1-3 & 8
Onderstepoort
OVI (1)
July 2007
*63 (56)
iOPV4 & 9
Onderstepoort
OVI
(1)
May 2007
110 (103)
iOPV5 & 10
Onderstepoort
OVI
(1)
February 2007
720 (657)
iOPV6 & 11
Onderstepoort
OVI
(1)
November 2006
1 329 (1 316)
iOPV13-22
Onderstepoort
OVI (1)
February 2007
846 (846)
iOPV7& 12,23-32
Onderstepoort
Kaalplaas (1)
March 1996
iKP1 & 2
Onderstepoort
Kaalplaas
(1)
August 2007
1 054 620
(1 048 292)
145 (141)
Western Cape Province
iStelBea1 & 2
Stellenbosch
Beaumont (6)
April 2007
14 590 (14 451)
iStelTr1 & 2
Stellenbosch
Trough End (6)
April 2007
3 774 (3 662)
iStelRiv1 & 2
Stellenbosch
Riverworld (5)
April 2007
247 (203)
iStelWod1 & 2
Stellenbosch
Woodhill (4)
May 2007
7 519 (7 136)
iStelKun 1 & 2
Stellenbosch
Kunnenberg (5)
May 2007
374 (290)
iStelBon1-5
Stellenbosch
Bona Vista (1)
Jan 2006
1 280 (922)
iStelKen1-8
Kenilworth
October 2007
41 (35)
iStelRob1-6
Robertson
Quarantine Station
(1)
Nerina Guest Farm
(2)
January 2007
3 572 (3 237)
Wicklow Trust (2)
March 2007
661 (196)
Eastern Cape Province
iUITWic1-20
Kirkwood
Key = OVI – Onderstepoort Veterinary Institute
*The total numbers of Culicoides specimen collected at each site are indicated in
bold and the numbers of catches for C. imicola are shown in brackets.
26
Culicoides bolitinos were collected from four areas, viz eastern part of the Free
State Province (Clarens), eastern (George) and western (Stellenbosch) Western
Cape Province and Eastern Cape Province (Port Elizabeth) (Fig. 3.2). Midges
were collected at more than one collection site within each of the four areas.
Clarens is 266 km north-east of Bloemfontein and 500 km south of
Onderstepoort (Pretoria) and is a summer rainfall area. At the higher lying
Clarens, heavy frost and occasional snow can be found in winter.
Figure 3.2: Map showing areas in South Africa where Culicoides bolitinos were
collected (Chantel De Beer, ARC-OVI). Light trap collection sites are represented
by small green circles inside the big red circles.
27
Table 3.2 Culicoides abundance and Culicoides bolitinos representation as
determined with light traps at the collection sites where C. bolitinos were collected
for phylogenetic analysis (unpublished data Venter & Labuschagne, ARC-OVI)
Sample
Locality
Name
Farm (No. of light
Collection date
trap collections)
Average No. of
Culicoides
collected/night
Free State Province
March 2001
*715 (266)
(9)
March 2007
1 140 (1 082)
(2)
January 2007
bCLA1-2
Clarens
Koeberg (1)
bCLA3-5
Clarens
Koeberg
bCLA6-15
Clarens
Koeberg
880 (640)
Western Cape Province
4 114 (3 316)
Geo1
George
Outeniqua (9)
November 2006
Geo2-4
George
Kidbuddie (3)
October 2007
Geo8-15
George
Riding Club (1)
November 2007
358 (277)
bStel1-3
Stellenbosch
Robertsvallei (10)
April 2007
111 (47)
bStel4-7
Stellenbosch
Bona Vista (1)
January 2007
1 178 (1 178)
bStel8-15
Stellenbosch
Rozendal (1)
February 2007
1 590 (885)
January 2007
700 (669)
April 2007
739 (602)
March 2007
661 (228)
66 (37)
Eastern Cape Province
bPE1-3
Port Elizabeth
Ascot Stud (5)
bPE4-7
Port Elizabeth
Ascot Stud
bUIT8-15
Kirkwood (PE)
Wicklow Trust (2)
(1)
*The total numbers of Culicoides specimen collected at each site are indicated in bold and
the numbers of catches for C. bolitinos are shown in brackets.
28
3.3 DISCUSSION
Culicoides imicola was abundant at all the collection sites from which specimens
of this species were used for phylogenetic analyses (Table 3.1). Its
representation varied from 29.7% at Wicklow Trust to 99.4% at Kaalplaas (Table
3.1). Except for the collections made at Wicklow Trust, C. imicola was the
dominant species to be collected at all of these sites (Table 3.1). In the two
collections made at Wicklow Trust, C. bolitinos represent 34.5% of a nightly
average of 661 Culicoides midges collected (Table 3.1). The largest collection of
1 054 620 Culicoides of which C. imicola represented 99.4% was made in a
single night at Kaalplaas in March 1996 (Table 3.1) (Meiswinkel et al. 2004a).
Such large collections are not unusual during warm wind free nights during years
of above average rainfall. The large numbers and dominance obtained in the
present study (Table 3.1) confirms previous results which indicate C. imicola to
be the dominant livestock associated Culicoides species in the warmer, frost-free
summer and winter rainfall areas of South Africa (Meiswinkel 1989; Venter 1991;
Venter et al. 1996; Meiswinkel et al. 2004a; Venter et al. 2006b).
Culicoides bolitinos was abundant at all the sites sampled for the phylogenetic
analyses of this species (Table 3.2). Culicoides bolitinos is found in most areas
where C. imicola is present (Meiswinkel et al. 2004a). Because C. bolitinos
breeds in bovine dung (Meiswinkel & Dyce 1989; Meiswinkel 1989), it is
generally accepted that C. bolitinos will be found in all areas where bovines are
present. This close association with cattle probably increases the vectorial
capacity of this species for BTV. Previous light trap surveys indicate that, due to
its more stable temperature breeding habitat it can become more abundant than
C. imicola in the cooler parts of the country (Venter & Meiswinkel 1994;
Meiswinkel et al. 2004b), e.g. Clarens (Table 3.2). In some areas the abundance
of these two species can vary according to the climatic and/or environmental
conditions during a specific year or season. This was illustrated by the collections
made at Bona Vista (Stellenbosch). In January 2006 C. bolitinos accounted for
29
72% of 1 280 of Cuicoides collected (Table 3.1). The next year, January 2007, C.
imicola represented 100% of 1 178 Culicoides collected (Table 3.2).
The light trap collections made at the quarantine station in Kenilworth yielded the
lowest number of Culicoides midges (Table 3.1). This can be attributed to the
windy conditions and the sandy soil that is not ideal for Culicoides midges.
Lower numbers of midges were collected during winter and higher numbers
during summer. Table 3.1 shows that low numbers were collected at
Onderstepoort during May, July and August 2007 and that the largest collections
were made between November 2006 and February 2007. This seasonal
fluctuation in Culicoides numbers coincide with the seasonal occurrence of
outbreaks of AHS in the country (Baylis et al. 1999).
The number of midges collected with light traps as reflected in the Tables 3.1 and
3.2 may represent less than 0.0001% of the total midge population in the area
(Meiswinkel et al. 2004a). Comparisons of Culicoides numbers and especially the
abundance of C. imicola in collections made in the presence and absence of
cattle indicate that host animals will be the primary attraction for Culicoides
midges and that light traps primarily sample midges already in the near vicinity of
the host (Venter et al. in press).
30
CHAPTER 4
GENETIC
ANALYSIS
OF
CULICOIDES
POPULATIONS
USING
MITOCHONDRIAL CYTOCHROME OXIDASE I GENE FRAGMENT
4. 1 INTRODUCTION
The aim of the work done in this chapter was to extract DNA from individual C.
imicola and C. bolitinos specimens, amplify specific fragment of the COI by PCR
for sequencing. This data was then used in subsequent sequence and
phylogenetic analysis according to the methods described in Chapter 2. The
analysed data was compared with the homologous sequences from GenBank.
4.2 RESULTS
4.2.1 Primer selection
A set of oligonucleotide primers (C1-J and C1-N) from the conserved region of
mitochondrial COI described by Dallas et al. (2003), were used to amplify DNA.
These are the modified version of primers described by Linton et al. (2002). It
was found that the original C1-J primer could form a 3’ hairpin with a melting
temperature of 54°C that could interfere with PCR priming and a 4 bp 3’
intermolecular duplex that could promote primer-dimer formation, hence it was
modified together with C1-N to ensure similar annealing temperatures (Dallas et
al. 2003). Details of the primers used are shown in Table 4.1 and were
synthesized by Inqaba Biotechnical Industries (Pty) Ltd (Pretoria, South Africa).
Upon arrival, the lyophilized oligo pellets were re-suspended and diluted to 100
µM using sterile TE buffer (10 mM Tris, Ph 8, 1 mM EDTA) and stored at -20°C.
This primer concentration was diluted to 10 µM using nuclease-free water for
direct use in all PCR reactions.
31
Table 4.1 Cytochrome Oxidase I primers, size of amplicon and their nucleotide sequences
Primer
Orientation
Amplicon
Primer sequence
Reference
name
of primer
size (bp)
C1-J-1718
Forward
522
5’-GGAGGATTTGGAAATTGATTAGT-3’
Dallas et al, 2003
C1-N-2191
Reverse
522
5’-CAGGTAAAATTAAAATATAAACTTCTGG-3’
Dallas et al, 2003
4.2.2 Midge DNA extractions and PCR amplification
Genomic DNA was successfully extracted from whole individual midges as
described in section 2.4. Approximately 10-40 ng of DNA, which was sufficient for
both PCR and sequencing reactions, wAS extracted. Specimens older than one
year and which were not properly stored in ethanol yielded the lowest DNA
concentration of below 10 ng. PCR using the COI primers yielded an amplicon
that corresponded to the predicted size of 522 bp (Fig. 4.1).
M N
1 2
3
4
5
6 7 8
9 10 11 12
2642 bp
500 bp
522 bp
50 bp
Figure 4.1: A 1.2% TBE agarose gel showing the COI amplification products
from C. imicola individuals from various geographical regions of South Africa.
Lanes: M = Molecular Weight Marker; N = negative control; 1-4 = Onderstepoort;
5-8 = Stellenbosch; 9-12 = Kirkwood
32
M
1
2
3
4
5
6
7
8
9
10 11 12
522 bp
500 bp
Figure 4.2: A 1.2% TBE agarose gel showing the COI amplification of C.
bolitinos individuals from various geographical regions of South Africa. Lanes: M
= Molecular Weight Marker; 1-3 = Clarens; 4-6 = George, 7-9 = Stellenbosch; 1011 = Port Elizabeth.
4.2.3 Purification of the PCR product and nucleotide sequencing
All the samples that could be visualised on the agarose gel after performing gel
electrophoresis were purified as explained in section 2.5 and were cyclesequenced using the same primers used for the PCR. The nucleotide
sequencing yielded an average of approximately 492-522 bp readable bases
from each reaction. Nucleotide sequences were aligned and trimmed on both
ends to generate homologous stretches of 472 bp that were representative of all
specimens. These 472 bp sequences were used for multiple alignments. The
multiple sequence alignments are shown in Appendix 1, 2 and 3. Culicoides
imicola and C. bolitinos GenBank sequences were included in the alignments to
verify and compare with sequences generated in this study.
33
4.2.4 Phylogenetic analysis
The multiple sequence alignments generated in this study were used to construct
phylogenetic trees using the Neighbor-joining (N-J) method. The N-J method was
appropriate for the construction of the phylogenetic trees due to its high
computational speed and the ability to incorporate a large amount of data. The
tree in Fig. 4.3 was constructed using the multiple sequence alignment shown in
appendix 1 to compare the relationship between the C. imicola and C. bolitinos
and to confirm that individuals of the two species are grouped separately. The
trees in Figs 4.4 and 4.5 were constructed using the sequence alignment shown
in Appendix 2 and 3 respectively. This was done to determine phylogenetic
relationship of midges of one species from different geographic localities.
Table 4.2 Details of the GenBank sequences included in the phylogenetic analysis
Species
Origin
Isolate No. Isolation date GenBank
accession No.
C. imicola
Onderstepoort (S.A)
IMI 11
09 Jan 2006
AF069249
C. imicola
Onderstepoort (S.A)
IMI 15
09 Jan 2006
AF069232
C. imicola
Onderstepoort (S.A)
IMI 16
07 Jan 2005
AF069233
C. imicola
Spain: Constatina
SCON 7
12 July 1999
AF080537
C. imicola
Spain: Constatina
SCON 9
12 July 1999
AF080539
C. imicola
Portugal: Alter de Chao
ADC 19
03 Nov 1999
AF079975
C. imicola
Portugal: Evora
PEV 1
03 Nov 1999
AF079977
C. imicola
Israel: Bet Degan
IBET 1
03 Nov 1999
AF078097
C. bolitinos
Clarens (S.A)
BOL 14
09 Aug 2002
AF071928
C. bolitinos Clarens (S.A)
BOL 17
09 Aug 2002
AF071929
C. bolitinos
Clarens (S.A)
BOL 20
09 Aug 2002
AF071930
C. bolitinos
Clarens (S.A)
BOL 22
09 Aug 2002
AF071931
C. tuttifrutti
Kimberly (S.A)
TUT 1
07 Jan 2005
AF069242
C. tuttifrutti
Kimberly (S.A)
TUT 3
07 Jan 2006
AF069244
C. tuttifrutti
Kimberly (S.A)
TUT 6
07 Jan 2006
AF069245
C. tuttifrutti
Kimberly (S.A)
TUT 7
07 Jan 2006
AF069246
34
Table 4.3: Explanations of the symbols used on the phylogenetic trees
Symbol
Explanation
Species name
i
C. imicola
b
C. bolitinos
Collection/study areas
OP
Onderstepoort (Gauteng Province)
Kp
Kaalplaas (Onderstepoort area)
V
Onderstepoort Veterinary Institute
PE
Port Elizabeth (Eastern Cape province)
Cla
Clarens (Free State province)
Geo
George (Western Cape province)
Stel
Stellenbosch (Western Cape Province)
Farms in and around Stellenbosch
Bea
Beaumont
Tr
Troughend
Riv
River world
Kun
Kunnelberg
Bon
Bona Vista
Ken
Kenilworth racing course
Rob
Robertson (Nerina guest farm)
Wod
Wood hill
Farm near Port Elizabeth
Wic
Wicklowtrust
Meaning of numbers
1 – 20
Sample number from that area
35
Figure 4.3: Neighbor-joining tree constructed from alignments of 472 bp partial
nucleotide sequences of the mitochondrial DNA cytochrome oxidase subunit I
(COI) gene of two members of the Imicola Complex. The horizontal branch
lengths are proportional to the divergence between sequences within and
between groups and vertical lines are for clarity purpose only. Letter n represents
number of identical individuals from the same area. The species names
corresponding to the abbreviations are listed in Tables 4.2 & 4.3.
36
Table 4.4 The 14 COI haplotypes for C. imicola populations from different geographic areas
Population
Site code
Number of
Number of
IMICOI
specimens
haplotypes
haplotype
OVI
KP
17
4
Bea
Bon
Ken
Kun
Riv
Rob
Tri
Wod
1
5
3
1
2
5
2
2
Kirkwood
Wic
13
Spain: Constantia
SCON
2
Portugal: Alter de Chao
ADC
1
Israel: Bet Degan
IBET
1
Portugal: Evora
PEV
1
Onderstepoort
Stellenbosch
4
01, 02,03,04
5
03,04,05,06,07
2
08,09
5
10,11,12,13,14
IMI11 was used as a reference sequence to determine haplotype structures of
various C. imicola individuals.
37
Table 4.5 The COI diversity of C. imicola populations from different geographic areas
Population
Nucleotide
Standard Deviation Haplotype
Diversity (Pi)
(SD)
No. of Polymorphic
Diversity (Hd) Sites (S)
Onderstepoort
0.00407
0.044
0.655
5
Stellenbosch
0.00203
0.063
0.655
3
Kirkwood
0.00078
0.091
0.369
1
Overall results
0.00524
0.0147
0.864
8
Explanations: Nucleotide diversity is the average number of nucleotide differences per
site between any two DNA sequences chosen at random from the population. It is used
to measure the degree of polymorphism or genetic variation within a population.
Haplotype diversity measures the uniqueness of a certain haplotype in a population.
Standard deviation is a measure of dispersion or variation of a statistical data set and
shows how much variation there is from the mean. The values above were calculated
using DnaSP 4.0 (Rozas et al. 2003).
38
Figure 4.4: Phylogenetic relationships determined using partial nucleotide
sequences of the C. imicola mitochondrial DNA cytochrome oxidase I gene
fragments of individual midges. A Neighbor-joining tree was constructed from
alignments of 472 bp of single C. imicola species from the three different
geographical areas with bootstrap proportion of 1 000 replicates. Homologous
sequences from C. bolitinos (BOL22) and C. tuttifrutti (TUT1) were used to root
the tree. The nucleotide substitution per site is indicated by the scale bar.
Populations are described by different colours: Black - GenBank, Purple Onderstepoort, Red – Stellenbosch, Green – Kirkwood.
39
Table 4.6 The 11 COI haplotypes for C. bolitinos populations from different geographic areas
Population
Site code
Number of
Number of
specimens
haplotypes
BOLCOI haplotype
Clarens
Cla
13
3
01, 02,03
George
Kid
Rid
Oute
4
8
1
4
04, 05,06,07
Stellenbosch
Far
Rob
Ros
2
3
7
2
01,08
12
4
01,09,10,11
Port Elizabeth
Asc
The BOL22 sequence was used as a reference sequence to determine haplotype
structures of C. bolitinos individuals.
Table 4.7 The COI diversity of C. bolitinos from different geographic areas
Population
Nucleotide
Standard Deviation Haplotype
No. of Polymorphic
Diversity (Pi)
(SD)
Sites (S)
Diversity (Hd)
Clarens
0.01195
0.094
0.455
14
George
0.02102
0.060
0.714
27
Stellenbosch
0.01220
0.074
0.443
13
Port Elizabeth
0.01961
0.078
0.665
24
Overall results
0.02151
0.042
0.734
32
40
Figure 4.5: Phylogenetic relationships among C. bolitinos determined using
partial nucleotide sequences of the mitochondrial DNA cytochrome oxidase I
gene fragments of individual midges. The nucleotide alignments of 472 bp were
used to construct the phylogenetic tree using neighbor-joining method. Numbers
at the nodes indicate bootstrap confidence values. The iOPV1 sequence was
used as an out group. Colours of different populations are: Black - GenBank,
blue - George, red – Stellenbosch, bright green – Port Elizabeth, ice blue –
Clarens.
41
4.3 DISCUSSION
The purpose of this chapter was to amplify the extracted midge DNA using a set
of COI primer (Table 4.1) previously described by Dallas et al. (2003), verify the
expected fragment size by loading the PCR product on an agarose gel (Figs 4.1
& 4.2), sequence the product and use phylogenetic trees to clarify the genetic
relationship between individuals and groups of midges collected at different sites
in South Africa.
In this study, the phylogenetic relationship of the C. imicola and C. bolitinos
species were established. Comparison of the multiple sequence alignments of
the two Culicoides species display variations within the COI region of the
mitochondria. The number of nucleotide substitutions or differences between
sequences of the two species occurred at 56 positions along a total length of 472
bases (Appendix 1). The most frequent substitutions were A-T tranversions
which occurred at 26 positions, followed by A-G transitions at 14 positions, T-C
transitions at 11 positions, T-G transitions at three positions and A-C transitions
at two positions. No G-C tranversions were observed and on average, most
transitions/transversions occurred sequentially every 10 bases. The nucleotide
base composition of the sequenced mitochondrial COI fragment has shown that
the Culicoides mitochondrial genome has a high A+T content. It was between 66
and 71% for all the species included in this study. These A+T percentages are
comparable to most insect species including Lybella cyanea with 66%, Gryllus
ovisopis 69%, Locusta migratoria and Chrothippus parrallelus both 70%
(Herbeck & Novembre 2003). In Othorpterathan fishes, the A+T content ranged
between 54 and 57% (Persis et al. 2009). The differences between these two
Culicoides species were further shown by their location on two separate
branches of the tree with high bootstrap values indicating confidence in the tree
topology (Fig. 4.4). The results of the phylogenetic analysis has shown that
although C. imicola and C. bolitinos sequences are clearly distinguishable from
each other, these two species appear to be genetically closer to each other than
to the other members within the Imicola complex (Linton et al. 2002).
42
4.3.1 Culicoides imicola
The genetic relationship of the C. imicola collected at Onderstepoort,
Stellenbosch and Kirkwood was determined. GenBank sequences of samples
from three European countries were included in the analysis for comparison and
verification. Comparison of the COI multiple sequence alignment has shown that
there are variations between sequences of individuals, these are, however, not
directly linked to geographic origin. Due to this, individual midges from
Onderstepoort and Stellenbosch could not be distinguished from each other and
are grouped together in subcluster 1D (Fig. 4.4). Sequences of midges from the
latter two areas are identical and also share haplotypes 03 and 04 (Table 4.4)
that are dominant in both areas. However, subclusters 1B and 1C suggest the
opposite since other members of these two populations clustered separately on
different clades and could be clearly identified by the possession of haplotypes
unique to their areas of origin. The results suggest that although there are
“genetic identities” of midges from the two areas, some members of these two
groups could be separated according to their geographical origin, low bootstrap
values, however, indicate low confidence in the branching pattern.
The most important feature observed in Fig. 4.4 is the differences shown by the
Onderstepoort C. imicola sequences generated in the present study and the
Onderstepoort sequences obtained from the GenBank (i.e. IMI11, IMI15 and
IMI16) which occur on separate clades. This difference was mainly due to the
substitutions of A by T at position 370 and G by A at position 424 of the
nucleotide sequence from the GenBank (Appendix 2). The same two
substitutions were the same as in a C. bolitinos (Bol 22) sequence included in the
alignment as an out group. This is a clear indication that these two species are
indeed closely related.
DnaSP 4.0 (Rozas et al. 2003) was used to measure the degree of genetic
variation within and between each group of midges. The low standard deviation
of a particular midge population serves as an indication of high genetic diversity
43
within that group of midges. For example, Table 4.5 and 4.7 clearly indicate that
in all populations, nucleotide diversity is inversely proportional to its standard
deviation. The results have shown that the Onderstepoort midges are the most
diverse and highly variable of the three as indicated by the highest nucleotide
diversity, Pi=0.00407 and the lowest standard deviation, SD=0.044 (Table 4.5),
hence they are wide spread on the phylogenetic tree (Fig. 4.4). These values are
higher than the combined total average for all study areas. Also the genetic
diversity of the Kirkwood population is the lowest of the three as indicated by the
highest SD and the lowest Pi.
Although large number of Onderstepoort and Stellenbosch samples in this study
are genetically identical, all the Kirkwood samples have clearly shown to be
distinct from the rest as they are grouped separately from others within
subcluster 1E (Fig. 4.4), and this is supported by a high bootstrap value of 70%.
The presence of the two unique haplotypes (i.e. haplotype 08 and 09) found in
this population (Table 4.4) and the substitution of C by A at position 1 of their
nucleotide sequences which is common in all members of this population
(Appendix 2) indicates the existence of a C. imicola subpopulation in the
Kirkwood area. However, further studies would be required to confirm this. The
results of the DnaSP have shown that sequences of individuals from the
Kirkwood area are less diverse compared to sequences of midges from the other
two areas as shown by the lowest nucleotide diversity, Pi=0.00078 and highest
standard deviation, SD=0.091 (Table 4.5). These results indicate that this
population is stable and that breeding with midges from other areas might not
have occurred in the recent past. This could mean that an outbreak of AHS
disease in Kirkwood might not spread via infected midges to other areas such as
Stellenbosch or Onderstepoort. This does, however, not preclude the spread of
the virus via infected hosts.
Samples of C. imicola from Europe included are easily distinguishable from
South African samples due to the possession of unique haplotypes (Table 4.4)
44
and different nucleotide sequences (Appendix 2). This has also been shown by
the location of these midges on a separate clade in subcluster 1A (Fig. 4.4). This
indicates that although there are small differences between midges from different
geographic areas in South Africa, South African populations can be clearly
distinguished from samples of European countries. These genetic differences
could be influenced by differences in environmental conditions that exist in those
parts of Europe (i.e. Israel, Portugal and Spain) and South Africa, and also by the
greater distances between the concerned areas.
The present results of the COI phylogenetic analysis for C. imicola from various
localities in South Africa have shown that in general, there is a very low level of
genetic divergence between local populations compared to midges from well
separated countries of the Mediterranean basin (Dallas et al. 2003). This low
genetic diversity is likely to be influenced by similar climatic conditions and the
closer geographic distances between the study areas situated within the same
country as opposed to distances between study areas that are situated in
different countries with different climates.
4.3.2 Culicoides bolitinos
Currently there is no published work on a detailed genetic study of C. bolitinos. In
this study an attempt was made to determine the genetic relationship between
different geographical populations of C. bolitinos midges. The sequence and
phylogenetic analysis of the four different South African populations (Port
Elizabeth, George, Stellenbosch and Clarens) of C. bolitinos were performed
using partial sequence of the COI gene of the mitochondrial genome. A multiple
sequence alignment was generated and a total of 17 nucleotide substitutions
were observed among individuals of different C. bolitinos populations along a
total length of 472 bp. The same multiple sequence alignment was used to
construct Fig. 4.5 which shows that there is a clear genetic diversity within this
species, however, this is not linked to the geographic origin. Therefore these
sequences do not provide any information about genetic differences of various
45
midge populations. However, variations were detected using DnaSP between
individual midges of each group from different locations. The results of the
DnaSP analysis have shown that midges from George are the most diverse of
the four as shown by the highest nucleotide diversity, Pi=0.02102, highest
haplotype diversity, HD=0.714 and the lowest standard deviation, SD=0.060 and
all these values are above the combined average of the four populations (Table
4.7). The genetic diversity of midges from this area is further shown by the
highest bootstrap values and the location of its individuals on four different
branches of the tree (Fig. 4.5). This George population has the highest number of
unique haplotypes that vary among its individuals (Table 4.6). These results may
indicate that breeding between midges from George and other areas does take
place, to a certain extent, and that if C. bolitinos is proven to be a vector, disease
might spread via infected vectors during an outbreak.
The tree has also shown that some members of C. bolitinos from Clarens, Port
Elizabeth and Stellenbosch areas are grouped together on a single branch due to
identical sequences as shown in subcluster 2A (Fig. 4.5), as well as the
possession of haplotype 01 that is dominant in midges from the three localities.
The individual midges which share similar haplotypes are closely related. The
mitochondrial COI gene could not provide any indication that geographical
population of this species are genetically separated. However, the branching
pattern between subcluster 2A and 2B (Fig. 4.5) suggests the existence of C.
bolitinos individuals of distinct genotypes.
4.4 CONCLUSION
The COI marker seems to reflect the geographical separation of the different C.
imicola populations, and this could be useful for phylogeographic and population
genetics studies. However, a further study will be required to confirm this.
There is a clear genetic divergence or separation within the species classified as
C. bolitinos according to morphological markers. These genetic subgroupings are
46
not artifacts as can be seen from their repeated occurrence within these
samples. It can be speculated that this might be a case of the so called “cryptic
species” and further investigations will be required for confirmation.
47
CHAPTER 5
PHYLOGENETIC ANALYSIS OF CULICOIDES POPULATIONS BASED ON
MITOCHONDRIAL 16S rRNA GENE FRAGMENT
5.1 INTRODUCTION
This chapter describes the amplification of a specific fragment of the
mitochondrial 16S rRNA gene for the species of C. imicola and C. bolitinos using
PCR. The DNA used in Chapter 4 were also used for analysis in this study. The
PCR products were used for sequencing and phylogenetic analysis as in the
previous chapter. The results of the two species were compared and discussed.
5.2 RESULTS
5.2.1 Primer selection
Culicoides imicola 16S rRNA partial gene sequence obtainable from the
GenBank (accession: AF083045) was used to design a pair of primers shown in
Table 5.1. These primers were used for PCR as well as DNA sequencing of the
two Culicoides species.
Table 5.1 16S rRNA primers, binding sites, sizes and their nucleotide sequences
Primer Name
Orientation
Primer
Amplicon
Primer Sequence
of primer
binding site
size (bp)
16S rRNA 1A
Forward
71-90
468
5’- CCGCAGTATACTGACTGTGC -3’
16S rRNA 1B
Reverse
515-538
468
5’-ATCATGTAAGAATTCAAAAGTCG-3’
5.2.2 PCR and nucleotide sequencing
A volume of 5 µl genomic DNA (0.5-1 µg) was amplified using the 16S rRNA
primers described in Table 5.1. Both C. imicola and C. bolitinos DNA were
successfully amplified using this set of primers. The size of the PCR products
was approximately 460 bp (Fig. 4.1). Cycle sequencing was done using
approximately 5-20 ng of purified PCR product with the same primers that were
48
used for PCR. The nucleotide sequencing produced sequences ranging from
445-475 bp.
M
N
1
2
3
4
5
6
7
8
9
10
450 bp
460 bp
250 bp
Figure 5.1: A 1.2% TBE agarose gel showing 16S rRNA-specific PCR products
from the individual C. imicola and C. bolitinos from various regions of South
Africa. Lanes M = Molecular Weight Marker (50 bp), Lane N = negative control
with no DNA, Lane 1-5 = C. imicola, Lane 6-10 = C. bolitinos. The gel shows a
uniform banding pattern for both species with an approximate size of 460 bp
5.2.3 Phylogenetic analysis
Phylogenetic analysis was done as explained in section 4.2.4. Sequences of 445
bp were generated after trimming the 16S rRNA multiple sequence alignments.
The C. imicola and C. bolitinos phylogenetic trees were constructed based on 57
and 53 nucleotide sequences respectively. Fig. 5.2 was used to determine the
relationship of the two species. Different colours were used in Figs 5.3 & 5.4 to
49
differentiate individuals from different localities. GenBank sequences (Table 5.2)
were included to compare with the sequences generated in this study. Multiple
sequence alignments shown in Appendix 4, 5 and 6 were used to construct the
phylogenetic trees in Figs 5.2, 5.3 & 5.4 respectively using Neighbor joining
method (Saitou & Nei 1987).
50
Table 5.2 Culicoides GenBank sequences included in this investigation
Species and code
Isolation year
Place of origin
Genbank
Accession no.
C. tuttifrutti NHMT15
May 2004
Kimberly, S.A
AY294137
C. imicola RSA 1
July 1999
Onderstepoort, S.A
AF083045
C. imicola RSA 2
July 1999
Onderstepoort, S.A
AF083048
C. imicola RSA 6
July 1999
Onderstepoort, S.A
AF083046
C. imicola RSA 10
July 1999
Onderstepoort, S.A
AF083047
C. imicola NHM161
May 2004
Onderstepoort, S.A
AF294138
C. imicola NHM171
May 2004
Onderstepoort, S.A
AF294139
C. imicola NHM181
May 2004
Onderstepoort, S.A
AF294140
C. imicola NHM191
May 2004
Onderstepoort, S.A
AF294141
C. imicola AOND 1
January 2001
Onderstepoort, S.A
AF281314
C. imicola AOND 2
January 2001
Onderstepoort, S.A
AF281317
C. imicola AOND 6
January 2001
Onderstepoort, S.A
AF281315
C. imicola AOND 10
January 2001
Onderstepoort, S.A
AF281316
C. imicola IBET 15
July 1999
Israel: Bet Dagan
AF083054
C. imicola IBET 18
July 1999
Israel: Bet Dagan
AF083055
C. imicola IBET 31
July 1999
Israel: Bet Dagan
AF083057
C. imicola IBET 35
July 1999
Israel: Bet Dagan
AF083058
C. imicola IBET 45
July 1999
Israel: Bet Dagan
AF083059
KEY: RSA = Republic of South Africa, SA = South Africa, NHM = Onderstepoort
Isolate name, AOND = Onderstepoort isolate name, IBET = Israel Bet isolate
name.
51
Figure 5.2: Phylogenetic relationships among the two members of the Imicola
Complex analysed using mitochondrial 16S rRNA gene fragments. Neighborjoining tree constructed from alignments of 445 bp partial nucleotide sequences
of the mitochondrial DNA.
52
Table 5.3 Comparison of twenty one 16S rRNA haplotypes for C. imicola populations
from different geographical areas generated using DnaSP (Rozas et al. 2003)
Population
Onderstepoort
Site Code
OVI
KP
Number of
Number of
specimens
haplotypes
20
4
IMI16S haplotype
9
01, 02,07,08,09,
10,11,12,13
Stellenbosch
Bea
Bon
Ken
Kun
Riv
Rob
Tri
1
2
2
2
3
3
1
4
14,15,16,17
Kirkwood
Wic
13
4
14,19,20,21
Bet Dagan
IBET
5
5
01, 03,04,05,06
(Israel)
Table 5.4 Statistical values used to estimate the 16S rRNA diversity of C. imicola from
different geographic areas in South Africa (Rozas et al. 2003)
Population
Nucleotide
Standard
Haplotype
No. of Polymorphic
Diversity (Pi)
Deviation (SD)
Diversity (Hd)
Sites (S)
Onderstepoort
0.00814
0.075
0.649
22
Stellenbosch
0.00309
0.111
0.487
10
Kirkwood
0.00492
0.081
0.665
8
Overall results
0.00787
0.025
0.832
31
53
Figure 5.3: Phylogenetic relationships of the Culicoides imicola based on
mitochondrial 16S rRNA gene fragments of individual midges from different
localities. The DNA nucleotide alignment of 445 bp was used to construct the
phylogenetic
tree
using
Neighbor-joining
method.
Culicoides
tuttifrutti
(tuttiNHMT15) was used as an out group to root the tree. Populations are
described by different colours; Black - GenBank, Purple - Onderstepoort, Red –
Stellenbosch, Green - Kirkwood
54
Table 5.5 Comparison of the nineteen 16S rRNA haplotypes for C. bolitinos populations
from different geographical areas generated using DnaSP (Rozas et al. 2003)
Population
Site Code
No. of
specimens
13
No. of
haplotypes
6
BOL16S haplotype
Clarens
Cla
01, 02,03,04,05,06
George
Geo
13
6
07, 08,09,10,11,12
Stellenbosch
Far
Ros
2
11
5
07, 09,13,14,15
Port Elizabeth
Wic
13
5
07,16,17,18,19
Table 5.6 Statistical values used to estimate 16S rRNA diversity of C. bolitinos
from different geographic areas in South Africa (Rozas et al. 2003)
Population
Nucleotide
Standard
Haplotype
No. of Polymorphic
Diversity (Pi)
Deviation (SD)
Diversity (Hd)
Sites (S)
Clarens
0.16813
0.071
0.751
171
George
0.04143
0.037
0.837
42
Stellenbosch
0.03045
0.114
0.551
41
Port Elizabeth
0.00435
0.051
0.810
6
Overall results
0.0832
0.042
0.870
196
55
Figure 5.4: Phylogenetic relationships among Culicoides bolitinos from different
regions of South Africa. The DNA nucleotide alignment of 446 bp was used to
construct the phylogenetic tree using Neighbor-joining method. TuttiNHMT15
was used as an out group to root the tree. Populations are described by different
colours: Black - GenBank, dark blue: George, Ice blue: Clarens, Red:
Stellenbosch, Green: Port Elizabeth
56
5.3 DISCUSSION
In this chapter, the 16S rRNA gene was used for the characterisation of C.
imicola and C. bolitinos samples used in Chapter 4. Amplified PCR products of
460 bp (Fig. 5.1) for the two species were sequenced. Sequences of the 16S
rRNA gene fragment for the two Culicoides species have shown that their
nucleotide base composition has high A+T content like most other insect
mitochondrial rRNA sequences (Xiang & Kochar 1991; Shouche & Patole 2000).
It was on average 80% and 82% for C. bolitinos and C. imicola sequences
respectively. Fig. 5.2 shows that C. imicola and C. bolitinos from South Africa
belonged to different phylogenetic clades of 16S rRNA, and are phylogenetically
distinct from each other. This is as expected from two distinct species and
confirmed the classification of the specimens on morphological basis. The high
bootstrap value of 99% observed between main branches of the two Culicoides
species indicates high confidence in the tree topology.
5.3.1 Culicoides imicola
The relationship between C. imicola midges collected in all study areas was
determined using the mitochondrial 16S rRNA gene sequences. A total of 56 C.
imicola sequences were included in the analysis. Comparison of sequences
through multiple sequence alignment has shown that the total number of
substitutions within individuals of C. imicola was 16 over a total length of 445
bases. These differences were observed in 21 individual midges of which 12 are
from Onderstepoort. The most common substitution was the transition type which
accounted for approximately 74% of the total substitutions in C. imicola
(Appendix 5). These substitutions were not linked to midge geographic origin.
Culicoides imicola collected in Kirkwood and Stellenbosch could be easily
distinguished from those collected in Onderstepoort due to the substitution of A
by T at position 442 and T by C at 444th base in all sequences and also share
haplotype 14 (Table 5.3) which is dominant within the two populations. This has
also been shown by the clustering together of midges from the two areas (Fig
5.3), however, the low bootstrap values indicates low confidence in the tree
57
topology. These results do not correlate with the findings made using COI gene
analysis where Kirkwood midges appeared as a distinct genotype. This shows a
limited ability of this gene to separate midges from this area according to
geography.
Similarly, as in the previous chapter, Table 5.4 and 5.6 show that the nucleotide
diversity which reflects genetic diversity is always inversely proportional to the
standard deviation (i.e. the lower the standard deviation the higher the genetic
diversity and vice-versa). The results from DnaSP have shown that C. imicola
from Onderstepoort are more diverse and highly variable than midges from the
other two study areas as indicated by the highest nucleotide diversity, Pi=0.0814
and the lowest standard deviation, SD=0.075 (Table 5.4). This diversity has also
been shown by the wide spread of individuals from Onderstepoort on the
phylogenetic tree (Fig. 5.3). This results correlate with the findings made using
COI in Chapter 4 and support the notion that Onderstepoort midges do
interbreed with midges from other areas in this study and that an outbreak of a
disease in this region is likely to spread via infected vectors to other locations.
High genetic diversity of the C. imicola from this region could also be influenced
by the abundance of this species in the region (i.e. high numbers increases
chances of breeding with individuals of different genotypes which may increase
variations).
Midges from Bet Degan (Israel) and Onderstepoort (South Africa) are clustered
together in subcluster 3C and 3D (Fig. 5.3) due to identical sequences, which
indicates that the 16S rRNA partial gene fragment fails to discriminate individuals
from two different countries on separate continents. The two groups of midges
also share haplotype 01 which is not found in both Kirkwood and Stellenbosch
midges (Table 5.3). This implies that if the 16S rRNA cannot distinguish between
midges originating from different hemispheres, it is highly unlikely that it will be
able to distinguish between midges from different areas within a single country.
This partial gene fragment has low discriminating power in C. imicola compared
58
to COI as it could not separate midges from any of the three areas according to
geography. These results do not provide enough information that can be used to
predict disease spread and/or help with the implementation of control strategies.
5.3.2 Culicoides bolitinos
Sequence analysis of the C. bolitinos 16S rRNA gene has shown that the
transition and transversion substitutions accounted for 50% each. A multiple
sequence alignment of this species has shown a very low number of
substitutions observed at 14 different positions in 13 individuals along a total
length of 445 bp (Appendix 6). Most of these nucleotide substitutions occurred in
sequences of individuals caught in Clarens. The substitution of T by A at position
305 is the only unique character state that distinguishes Clarens population of C.
bolitinos from the other three. Midges from Clarens contain six unique haplotypes
with no shared haplotype and have been grouped separately from others as
shown in subcluster 4C (Fig. 5.4). However, the low bootstrap values indicate low
confidence in tree topology.
Phylogenetic analysis indicated that C. bolitinos midges from Stellenbosch,
George and Port Elizabeth are closely related due to clustering together in
subcluster 4A as a result of their identical sequences (Fig 5.4; Appendix 6).
Haplotype analysis has also indicated that haplotype 07 is dominant in
populations from Stellenbosch, George and Port Elizabeth whereas haplotype 09
is only dominant in Stellenbosch and George (Table 5.5). This is partly expected
since the latter two areas are geographically closer to each other than to Port
Elizabeth, hence two dominant haplotypes are shared by the two groups. It could
be that the closer the distance between the two study areas the more related
their midges will be. It is therefore assumed that low bootstrap values and high
sequence homology within this species is an indication that the 16S rRNA partial
gene has a very low discriminating power between populations of C. bolitinos
compared to that of the COI gene. Haplotype analysis, however, has shown that
59
midges from George are more diverse (HD=0.837) than midges from other areas
(Table 5.6).
5.4 Conclusion
The genetic analysis of midges using 16S rRNA marker has shown that there are
clear genetic diversities within C. imicola and C. bolitinos species. However, this
marker does not provide any meaningful information that reflects the geographic
origin of individual midges within the two species. Therefore this target region is
not appropriate for phylogeographic and population genetic studies. It could be
more likely due to the nature of this gene and the short area that was sequenced.
However, this partial gene could still be useful in determining the diversity of a
single Culicoides species within one area.
60
CHAPTER 6
6 GENERAL DISCUSSIONS AND CONCLUSIONS
In South Africa, the geographic distribution of the Culicoides species, in particular
that of C. imicola, has been well-described (Meiswinkel 1989; Baylis et al 1998;
Meiswinkel 2004b). Although most livestock associated Culicoides species, and
especially C. imicola, are found wide spread in the country, it is not clear to what
extent populations from different localities are genetically isolated from each
other. The dispersal of vectors in the country might be linked to the risk of virus
spread from one geographic area to another. It is known that the dispersal of
Culicoides can be influenced by environmental and geophysical factors acting as
natural barriers (Bishop et al. 2004). Since morphological characteristics are
usually inadequate to determine relationships among individuals and populations
of the midge vector species, genetic characterization was investigated for this
purpose.
The present work was intended to identify a suitable genetic marker that can
subsequently be applied to reveal subpopulations of C. imicola and C. bolitinos
with the objective of doing a phylogeographic and population genetic studies.
This study was partly motivated by oral susceptibility results that indicate that the
C. imicola population from Stellenbosch was significantly more susceptible to
AHSV serotype 8 (AHSV serotype 8 88/99 Pietermaritzburg) than the
Onderstepoort population of C. imicola (Venter et al. 2009). Although oral
susceptibility and vector competence are influenced by external environmental
factors, mainly are dependent on the genetic makeup of the vector midge
(Tabachnick 1991; Wellby et al. 1996; Mellor et al. 1998; Wittmann et al. 2001).
Differences in oral susceptibility in C. imicola from Onderstepoort and from
Stellenbosch suggested that these two populations could differ genetically.
Due to their rapid rate of evolution (Brown et al, 1979; 1982), mitochondrial
genes are believed to give better resolutions in population genetic studies than
61
nuclear DNA genes and hence were chosen for genetic analysis in this study.
Examples include the use of the ITS2 ribosomal nuclear DNA gene to determine
the phylogenetic relationship of C. obsoletus populations in Italy (Ludivik et al.
2005). The results indicated that there was no significant difference between and
within populations of this species, which suggested that ITS2 could not detect
any population substructures (Ludivik et al. 2005). The ITS1 nuclear ribosomal
DNA gene located between 18S and 5.8S was chosen, due to its well known
structural and evolutionary properties (Elder & Turner 1995), as a molecular tool
to study populations of Culicoides in France (Perrin et al. 2006). However, the
results from the French study indicated that populations of C. obsoletus and C.
imicola displayed 99.2% and 99.8% sequence identities respectively (Elder &
Turner 1995). This clearly indicated that these targeted regions of nuclear DNA
origin are not appropriate for genetic discrimination among individuals of the
same species.
Several authors have shown that mitochondrial COI has the ability to discriminate
various geographic populations of C. imicola in the Mediterranean basin (Dallas
et al. 2003; Nolan et al. 2008; Calvo et al. 2009). Similarly, macro-geographic
population structure was detected in populations of tsetse fly Glossina pallidipes
from six countries in East and southern Africa at the mitochondrial level using
16S ribosomal RNA (r16SII), COI, COII, fragment between cytochrome oxidase II
and transfer RNA leucine (COIITLII) and cytochrome B1 (cyB1) through SSCP
(Ouma et al. 2005). This clearly illustrates the ability of mitochondrial markers to
distinguish among populations of the same species in various insects species.
Based on that, COI and 16S rRNA were preferred markers in this study for the
analysis of populations of C. imicola and C. bolitinos in South Africa. The
selection of study areas were based on the association of the region with the
history of AHS outbreaks. It was hoped that the characterisation of these
populations would assist with the implementation of effective disease control
strategies based on the risk of the viral spread from endemic areas.
62
6.1 Intrapopulation variation
The molecular markers used have shown different results when used to detect
differences among midges within each sampling area for each of the two target
species. Both markers have indicated that individuals of C. imicola from
Onderstepoort were more variable compared to individuals from other regions as
reflected by high nucleotide diversities, high haplotype diversities, low standard
deviations, number of polymorphic sites (Tables 4.5 & 5.4) and the branching
patterns of the phylogenetic trees (Figs 4.5 & 5.3). This high genetic variation in
individuals of the Onderstepoort population could be the result of interaction of
this population with midges from other locations. Such interaction will support the
accepted idea that large number of C. imicola found in the north, due to warmer
temperatures, may eventually spread to the southern part of the country when
environmental conditions become suitable during the warmer summer months. It
is known that AHS can occur throughout the year in the north of the country
(Barnard 1993) and then spread towards the south. This southwards spread of
the virus could be attributed to midge movement.
The C. imicola population from Kirkwood is more uniform and has high sequence
identity. These identical sequences resulted in the clustering of midges from this
area on a single branch (Fig. 4.5) and have high standard deviation, low
nucleotide diversity and low number of haplotypes as well as few polymorphic
sites within the COI gene of individual midges (Table 5.4). This could indicate
that natural geographic barriers have isolated midges in this region from the
other study areas. The implication will be that AHS from other areas will not
spread via infected C. imicola into the area and visa versa. Based on the results
of the 16S rRNA gene, sequences of C. imicola from Kirkwood are not identical
as shown by COI gene. This part of the gene has shown that it could not
distinguish midges according to geography. Clear genetic diversities were
observed among C. bolitinos individuals within each study area when using COI,
however, the George population was the most diverse as shown by nucleotide
63
diversities, haplotype diversities, standard deviations as well as high bootstrap
values between branches.
6.2 Interpopulation variation
Generally, not many differences were observed between populations of each of
the two target Culicoides species. The exception being the clear genetic
differences, within the COI region of the mitochondrial DNA, that distinguish C.
imicola from Kirkwood from that of other areas. These differences were detected
through the analysis of the multiple sequence alignment (Appendix 2), haplotype
analysis (Table 4.4) as well as the branching pattern of the phylogenetic tree
(Fig. 4.5). Twelve of 22 individual C. imicola from Stellenbosch possess a distinct
genotype that could be used to separate them from midges of other areas as
shown by subcluster 1C (Fig. 4.5). However, the results of the COI gene of C.
imicola from Onderstepoort did not provide meaningful information that could be
used to classify them according to geography. Individual midges from the latter
area were always clustered together with midges from other regions.
The use of mitochondrial COI partial gene to characterise C. bolitinos based on
their geographic origin did not yield any significant results. The C. bolitinos
collected at different locations did not display any genetic differences according
to geography, but differences were clear between certain individuals of this
species regardless of their origin.
Genetic analysis of the C. imicola and C. bolitinos using 16S rRNA yielded very
limited information regarding the geographic origin of the two species. No
significant sequence differences were observed between C. imicola midges from
all study areas. The overall 16S rRNA results have shown that these midges are
genetically similar, however, minor sequence differences that were not linked to
geographical location, were observed within few individuals. Although. C.
bolitinos midges from Clarens have shown to possess unique haplotypes as well
as clustering together in subcluster 4C (Fig. 5.4), the low bootstrap values
64
indicate low confidence in tree topology. Therefore, these results did not provide
sufficient information that can be used to separate midges based on their
geography. Overall, the results obtained in the present study support the findings
made using RAPD markers whereby high level of genetic variation within South
African C. imicola populations were found, but this variation did not correlate with
geographic origin (Sebastiani et al. 2001).
6.3 Conclusion
Both markers have shown that the Onderstepoort population of C. imicola shares
some genetic similarities with midges from all other study areas. This could
indicate that Onderstepoort midges do interbreed with midges from other areas
thus suggesting that an outbreak of AHSV in this area could spread to other
localities in the vector. It does seem unlikely though, that this could happen
naturally between Onderstepoort and Stellenbosch populations. Another
explanation could be that midges might have been transported in one way or
another between the areas.
The COI partial gene could not distinguish any of the C. bolitinos midges
according to geography. It has, however, shown that there are two distinct
genotypes within this species in all sampled areas in South Africa because of the
clear genetic separation that was observed. This could indicate that some taxa
do not interbreed even though they are of the same species occurring within the
same location. As a result, phylogenetic analysis would not group these
individuals of C. bolitinos according to geography but based on their genetic
makeup and this could be an indication of a cryptic species. Genetic
characterization using different markers will be important in confirming this
finding. Overall, COI has the potential to resolve populations of C. imicola and
has shown to be a better marker than the 16S rRNA.
65
6.4 Recommendations
1.
More genetic markers will be needed to clarify South African midge
population structures, especially microsatellites markers which are known
to exhibit high discriminatory power and are more polymorphic.
2.
Increasing the sample size will improve the current knowledge of the
midge genetic structure in the country.
3.
It is recommended that additional areas (i.e. other South African Provinces
and neighbouring countries of the South African Development Community)
be sampled to improve the current understanding of the midge movement
and dispersal.
4.
These genetic studies need to be extended to include other equally wide
spread but the less abundant Culicoides species. E.g. Culicoides species
with more restricted breeding site preferences.
5.
Results generated by genetic analyses need to be supported by
taxonomical and biological studies.
66
CHAPTER 7
REFERENCES LIST
BARNARD, BJ.H. 1993
Circulation of African horsesickness virus in zebra
(Equus burchelli) in the Kruger National Park, South Africa, as measured by
the prevalence of type specific antibodies. Onderstepoort Journal Veterinary
Research, 60: 11-117.
BARNARD,
B.J.H.,
GERDES,
G.H.
&
MEISWINKEL,
R.
1998
Some
epidemiological and economical aspect of a bluetongue-like disease in
catlle in South Africa -1995/6 and 1997. Onderstepoort Journal of Veterinary
Research 65: 145-151.
BAYLIS, M., MEISWINKEL, R. & VENTER, G.J. 1998 A preliminary attempt to
use climate data and satellite imagery to model the abundance and
distribution of Culicoides imicola (Diptera: Ceratopogonidae) in Southern
Africa. Journal of South African Veterinary Association, 70: 80-89.
BAYLIS, M., MELLOR, P.S. & MEISWINKEL, R. 1999 Horse sickness and ENSO
in South Africa. Nature, 397: 574.
BEKKER, J.G., DE KOCK, G.v.d.W. & QUINLAN, J.B. 1934 The occurrence and
identification of bluetongue in cattle - the so-called pseudo-foot and mouth
disease in South Africa. Onderstepoort Journal of Veterinary Science and
Animal Industry, 2: 293-507.
BELL, R.A. 1999 Outbreak of African horse sickness in the Cape Province of
South Africa. The Veterinary Record, 144: 483.
67
BISHOP, A.L., SPOHR, L.J. & BARCHIA, I.M. 2004 Effects of altitude, distance
and waves of movement on the dispersal in Australia of the arbovirus
vector, Culicoides brevitarsis Kieffer (Diptera: Ceratopogonidae). Preventive
Veterinary Medicine, 65: 135-145.
BONFIELD, J.K., SMITH, K.F. & STADEN, R. 1995 A new sequence assembly
program. Nucleic Acids, 24: 4992-4999.
BORKENT, A. & WIRTH, W.W. 1997 World species of biting midges (Diptera:
Ceratopogonidae). Bulletin of American Museum of Natural History, 233:1257.
BOSMAN, P., BRÜCKNER, G.K. & FAUL, A. 1995 African horse sickness
surveillance systems and regionalisation/zoning: the case of South Africa.
Revue scientifique et technique, Office International des Epizooties, 14:
645-653.
BRAVERMAN, Y. 1988 Preferred landing sites of Culicoides species (Diptera:
Ceratopogonidae) on a horse in Israel and its relevance to summer
seasonal recurrent dermatitis (sweet itch). Equine Veterinary Journal, 20:
426-429.
BROWN, W.M., GEORGE, M. & WILSON, A.C. 1979 Rapid evolution of animal
mitochondrial DNA. Proceedings of the National Academy of Sciences, 76:
1967-1971.
BROWN, W.M., PRAGER, E.M., WANG, A. & WILSON, A.C. 1982 Mitochondrial
sequences of primates: tempo and mode of evolution. Journal of Molecular
Evolution, 18: 225-239.
68
CALISHER, C.H. & MERTENS, P.P.C. 1998 Taxonomy of African horse sickness
virus. Archives of Virology, 14: 3-11.
CALVO, J.H; CALVETE, C; MARTINEZ-ROYO, A; ESTRADA, R; MIRANDA,
M.A; BORRAS, D; SARTO I MONTEYS, V; PAGES, N; DELGADO, J.A;
COLLANTES, F. & LUCIENTES, J. 2009 Variation in the mitochondrial
cytochrome c oxidase subunit I gene indicate northward expanding
populations of Culicoides imicola in Spain. Bulletin of Entomological
Research, 99: 583-591.
CATERINO, M.S. & SPERLING, F.A.H. 1999 Papilio phylogeny based on
mitochondrial cytochrome oxidase I and II genes. Molecular Phylogeny and
Evolution, 11: 122-137.
COETZER, J.A.W. & ERASMUS, B.J. 1994 African horse sickness. In Infectious
Diseases of Livestock with Special Reference to Southern Africa (ed. by
J.A.W.Coetzer, G.R., Thomson and R.C. Tustin), pp. 460–475. Oxford
University Press, Cape Town.
DALLAS. J.F., CRUICKSHANK, R.H., LINTON, Y.M., NOLAN, D.V., PATAKAKIS,
M., BRAVERMAN, Y., CAPELA, R., CAPELA, M., PENA, I. MEISWINKEL, R.,
ORTEGA, M.D. BAYLIS, M., MELLOR, P.S. & MORDUE, A.J. 2003
Phylogenetic status and matrilineal structure of the biting midge, Culicoides
imicola, in Portugal, Rhodes and Israel. Medical and Veterinary Entomology,
17: 379-387.
DU TOIT, R.M. 1944 The transmission of blue-tongue and horse sickness by
Culicoides. Onderstepoort Journal of Veterinary Research, 19: 7-16.
69
DYCE, A.L. 1969 The recognition of nulliparous and parous Culicoides (Diptera:
Ceratopogonidae)
without
dissection.
Journal
of
the
Australian
Entomological Society, 8: 11-15.
DYE, C. 1992 The analysis of parasite transmission by bloodsucking insects.
Annual Review of Entomology, 37: 1-19.
ELDER, J.F. & TURNER, B.J. 1995 Concerted evolution of repetitive DNA
sequences in eukaryotes. The Quarterly Review of Biology, 70: 297-320.
ERASMUS, B.J., ADELAAR, T.F., SMIT, J.D., LECATSAS, G. & TOMS, T. 1970
The isolation and characterization of equine encephalosis virus. Bulletin de
Office International des Epizooties, 74: 781-789
ERASMUS, B.J., BOSHOFF, S.T. & PIETERSE, L.M. 1978 The isolation and
characterization of equine encephalosis and serologically related orbiviruses
from horses. In Proceedings of the fourth International Conference of
Equine Infectious Diseases, pp. 447-450. 24-27 September 1976 Lyon,
France.
GUTHRIE, A.J. 1999 Regionalisation of South Africa for African horse sickness.
In Proceedings of the 8th International Conference on Equine Infectious
Diseases (ed. by U. Wernery, J.F. Wade, J.A. Mumford and O.-R. Kaaden),
pp. 376-379. 23-26 March 1998, United Arab Emirates, Dubai.
HALL, T.A. 1999 BioEdit: a user-friendly biological sequence alignment editor
and analysis program for windows 95/98/NT. Nucleic Acid Symposium
Series, 41: 95-98.
70
HAMBY, R.K. & E.A. ZIMMER. 1992 Ribosomal RNA as a phylogenetic tool in
plant systematics, in Molecular systematics of plants, (ed. by P.S. Soltis;
D.E. Soltis and J.J. Doyle), pp. 50-92. Chapman and Hall, New York.
HARDY, J.L., HOUK, E.J., KRAMER, L.D. & REEVES, W.C. 1983 Intrinsic
factors affecting vector competence of mosquitoes for arbovirusses. Annual
Review of Entomology, 28: 229-262.
HEBECK, J.T. & NOVEMBRE, J. 2003 Codon usage patterns in cytochrome
oxidase I across multiple insect orders. Journal of Molecular Evolution, 56:
691-701.
HIGGINS, D. 2003 Multiple alignments. In The Phylogeny Handbook: A practical
approach to DNA and protein phylogeny, (ed. by M. Salemi and A.
Vandamme), pp. 45-69. Cambridge University Press, London.
HIGGINS, D.G. & SHARP, P.M. 1989 Fast and sensitive multiple sequence
alignments on a microcomputer. Cabios, 5: 151-153.
HILLIS, D.M. & BULL, J.J. 1993 An empirical test of bootstrapping as a method
for assessing confidence in phylogenetic analysis. Systematic Biology, 42:
182-192.
HOWELL, P.G. 1963 African horse sickness, in Emerging Diseases of Animals.
Rome: Food and Agriculture Organization of the United Nations, 71-108.
LINLEY, J.R. 1985 Biting midges (Diptera: Ceratopogonidae) as vectors of
nonviral animal pathogens. Journal of Medical Entomology, 22: 589-599.
71
LINTON, Y.-M., MORDUE (LUNTZ), A.J., CRUICKSHANK, R.H., MEISWINKEL,
R, MELLOR, P.S. & DALLAS, J.F. 2002 Phylogenetic analysis of the
mitochondrial cytochrome oxidase subunit I gene of five species of the
Culicoides imicola species complex. Medical and Veterinary Entomology,
16: 139-146.
LUDIVIK, M., GOMULSKI., MEISWINKEL, R., De LE’COLLE, J., GOFFREDO,
M. & GASPERI, G. 2005 Phylogenic relationships of the subgenus Avaritia
Fox, 1955 including Culicoides obsoletus (Diptera: Ceratopogonidae) in Italy
based on internal transcribed spacer 2 ribosomal DNA sequences.
Systematic Entomology, 30: 619- 631.
MAURER, F.D. & McCULLY, R.M. 1963 African horse-sickness with emphasis
on pathology. American Journal of Veterinary Research, 24:235-236.
MEISWINKEL, R. 1989 Afrotropical Culicoides: a redescription of C. (avaritia)
imicola Kieffier, 1913 (Diptera: Ceratopogonidae) with description of closely
allied C. (avaritia) bolitinos sp. nov. reared from dung of African buffalo,
blue wildebeest and cattle in South Africa. Onderstepoort Journal of
Veterinary Research, 56: 23-39.
MEISWINKEL, R. 1995 Afrotropical Culicoides: biosystemics of the Imicola
group, subgenus. Avaritia (Diptera: Ceratopogonidae), with special
reference to the epidemiology of African horse sickness. MSc. thesis.
University of Pretoria.
MEISWINKEL, R. 1997 Discovery of a Culicoides imicola-free zone in South
Africa: Preliminary notes and potential significance. Onderstepoort Journal
of Veterinary Research, 64: 81-86.
72
MEISWINKEL, R. 1998 The 1996 outbreak of African horse sickness in South
Africa - Entomological perspective. Archives of Virology, 14: 69-83.
MEISWINKEL, R. 2003 Adult key to the old world Imicola complex (Culicoides;
subgenus Avaritia Fox, 1955). Proceedings of the bluetongue congress,
Sicily, 59.
MEISWINKEL, R. & BAYLIS, M. 1998 Morphological confirmation of the separate
species status of Culicoides (Avaritia) nudipalpis Delfinado, 1961 and C.
(A.) imicola Kieffer, 1913 (Diptera: Ceratopogonidae). Onderstepoort
Journal of Veterinary Research, 65: 9-16.
MEISWINKEL, R. & DYCE, A.L. 1989 Afrotropical Culicoides: Synhelea Kieffer,
1925, resurrected as subgenus to embrace 10 species (Diptera:
Ceratopogonida). Onderstepoort Journal of Veterinary Research, 56: 147164.
MEISWINKEL, R., LABUSCHAGNE, K., BAYLIS, M. & MELLOR, P.S. 2004b
Multiple vectors and their differing ecologies: observations on two
bluetongue and African horse sickness vector Culicoides species in South
Africa. Veterinaria Italiana, 40: 296-302.
MEISWINKEL, R. & PAWESKA, J.T. 1998 The 1998 outbreak of horse sickness
in South Africa: A new Culicoides Latreille (Ceratopogonidae) vector?
Abstract, Fourth International Congress of Dipterology, 6-13 September
1998 Keble College, Oxford, United Kingdom.
MEISWINKEL, R. & PAWESKA, J.T 2003 Evidence for a new field Culicoides
vector of African horse sickness in South Africa. Preventive Veterinary
Medicine, 60:243-253.
73
MEISWINKEL, R., VENTER, G.J. & NEVILL, E.M. 2004a Vectors: Culicoides
spp, in Infectious Diseases of Livestock, edited by J.A.W Coetzer and R.C
Tustin. Cape Town: Oxford University Press, 93-136.
MELLOR, P.S., BONED, J., HAMBLIN, C. & GRAHAM, S.D. 1990 Isolation of
African horse sickness virus from vector insect made during the 1988
epizootic in Spain. Epidemiology & Infection, 105:447-454.
MELLOR, P.S., BOORMAN, J. & BAYLIS, M. 2000 Culicoides biting midges:
Their role as arboviral vectors. Annual Review of Entomology, 45: 307-340.
MELLOR, P.S., RAWLINGS, P., BAYLIS, M. & WELLBY, M.P. 1998 Effect of
temperature on African horse sickness virus infection in Culicoides.
Archives of Virology (Supplement), 14: 155-163.
NEVILL, E.M. 1968 A significant new breeding site of Culicoides pallidipennis
Carter, Ingram and Macfie (Diptera: Ceratopogonidae). Journal of the South
African Veterinary and Medical Association, 39: 61.
NEVILL, E.M. 1971 Cattle and Culicoides biting midges as possible overwintering
hosts of bluetongue virus. Onderstepoort Journal of Veterinary Research,
38: 65-72.
NEVILL, E.M., VENTER, G.J. & EDWARDES. 1992 Potential Culicoides vectors
of livestock orbiviruses in South Africa, in Bluetongue, African Horse
Sickness, and Related Orbivirurises (edited by T.E Walton and B.I Osburn).
Florida. CRC Press, 2: 306-313.
NOLAN, D.V., DALLAS, J.F. & MORDUE, A.J. 2004 Molecular taxonomy and
population structure of a Culicoides midge vector. Veterinaria Italiana, 40:
352-359.
74
NOLAN, D.V., DALLAS, J.F., PIERTNEY, S.B. & MORDUE, A.J. 2008 Incursion
and range expansion in the bluetongue vector Culicoides imicola in the
Mediterranean basin: a phylogeographic analysis. Medical and Veterinary
Entomology, 22: 340-351.
NOLLER, H.F., VAN STOLK, B.J., MOAZED, D., DOUTHWAITE, S & GUTELL,
R.R. 1985 Studies on the structure and function of 16S ribosomal RNA
using structure-specific chemical probes. Supplement Journal of Bioscience,
8: 747-755.
OIE ANIMAL HEALTH DEPARTMENT. 2006 Bluetongue – Netherlands,
Belgium, Germany – OIE. Promed.
OUMA, J.O; MARGUEZ, J.G & KRAFSUR, E.S. 2005 Macrogeographic
population structure of tsetse fly, Glossina pallidipes (Diptera: Glossinidae).
Bulletin of Entomological Research, 95: 437-447.
PASICK, J., HANDEL, K., ZOU, E-N., CLAVIJO, A., COATES, J. ROBINSON, Y.
& LINCOIN, B. 2001 Incursion of epizootic hemorrhagic disease into the
Okanagan Valley, British Columbia in 1999. Canadian Veterinary Journal,
42: 207-209.
PAWESKA, J.T., GERDES, G.H., WOODS, P.S.A. & WILLIAMS, R. 1999 Equine
encephalosis in southern Africa: Current situation. In Proceedings of the
Eighth International Conference on Equine Infectious Diseases, pp. 303305. 23- 26 March United Arab, Dubai.
PAWESKA, J.T. & VENTER G.J. 2004 Vector competence of Culicoides species
and the seroprevalence of homologous neutralizing antibody in horses for
six serotypes of equine encephalosis virus (EEV) in South Africa. Medical
and Veterinary Entomology, 18: 398-407.
75
PAWESKA, J.T., VENTER G.J. & MELLOR, P.S. 2002 Vector competence of
South African Culicoides species for bluetongue virus serotype 1 (BTV-1)
with special reference to the effect of temperature on the rate of virus
replication in C. imicola and C. bolitinos. Medical and Veterinary
Entomology, 16: 10-21.
PERRIN, C., CETRE-SOSSAH, B., MATHIEU, B., BALDET,T., DELECOLLE,
J.-C & ALBINA, E. 2006 Phylogenetic analysis of Culicoides species from
France based on nuclear ITS1-rDNA sequences. Medical and Veterinary
Entomology, 20: 219-228.
PERSIS, M., CHANDRA SEKHAR REDDY, A., RAO, L.M., KHEDKAR, G.,
RAVINDER, K. & NASRUDDIN, K. 2009 COI (cytochrome oxidase-I)
sequences based studies of Carangid fishes from Kakinada coast, India.
Molecular Biology Reports, 36: 1733-1740.
PURSE, B.V., MELLOR, P.S., ROGERS, D.J., SAMUEL, A.R., MERTENS, P.C.
& BAYLIS M. 2005 Climate change and the recent emergence of
bluetongue in Europe. Nature Reviews, 3: 171-181.
ROZAS, J., SANCHEZ-DELBARRIO, J.C., MESSEGUER, X. & ROZAS, R. 2003
DnaSP, DNA polymorphism analyses by the coalescent and other methods.
Bioinformatics, 19: 2496-2497.
SAITOU, N. & NEI, M. 1987 The neighbor-joining method: Anew method for
reconstructing phylogenetic trees. Molecular Biology and Evolution, 4: 406425.
76
SEBASTIANI, F., MEISWINKEL, R., GOMULSKI, M., GUGLIELMINO, C.R.,
MELLOR, P.S., MALACRIDA, A.R. & GASPERI, G. 2001 Molecular
differentiation of the Old World Culicoides imicola species complex (Diptera,
Ceratopogonidae) inferred using random amplified polymorphic DNA
markers. Molecular Ecology, 10: 1773-1786.
SELLERS, R.F., PEDGLEY, D.E. & TUCKER, M.R. 1977 Possible spread of
African horse sickness on the wind. Journal of Hygiene, Cambridge, 79:
279-298.
SHOUCHE, Y.S. & PATOLE, M.S. 2000 Sequence analysis of mitochondrial 16S
ribosomal RNA gene fragment from seven mosquito species. Journal of
Biological Science, 25: 361-366.
SIMON, C., FRATI, F., BECKERBACH, A., CRESPI, B., LUI, H. & FLOOK, P.
1994 Evolution, weighing and phylogenetic unity of mitochondrial gene
sequences and a compilation of conserved polymerase chain reaction
primers. Annals of the Entomological Society of America, 87: 651-701.
STANDFAST, H.A., DYCE, A.L. & MULLER, M.J. 1985 Vectors of bluetongue in
Australia. Laboratory infections of Culicoides debilipalpis and C. stellifer
(Diptera:Ceratopogonidae) with bluetongue virus. In Progress in Clinical and
Biological Research Bluetongue and Related Orbiviruses (ed. by T.L.
Barber and M.M. Jochim), pp. 177-186. Alan R. Liss, New York.
TABACHNICK, W.J. 1991 Genetic control of oral susceptibility to infection of
Culicoides variipennis with bluetongue virus. American Journal of Tropical
Medicine and Hygiene, 45: 666-671.
TABACHNICK, W.J. 2004 Culicoides and global epidemiology of bluetongue
virus infection. Veterinaria Italiana, 40: 145-150.
77
TAMURA, K., DUDLEY, J., NEI, M, & KUMAR, S. 2007 MEGA4: Molecular
Evolutionary Genetic Analysis (MEGA) software version 4.0. Molecular
Biology and Evolution 10.1093/molbev/msm092.
THEODORIDIS A., NEVILL, E.M., ELS, H.J. & BOSHOFF, S.T. 1979 Viruses
isolated from Culicoides midges in South Africa during unsuccessful
attempts to isolate bovine ephemeral fever virus. Onderstepoort Journal of
Veterinary Research, 46: 191-198.
THIRY, E., SAEGERMAN, C., GUYOT, H., KIRTEN, P., LOSSON, B., ROLLIN,
F., BODMER, M., CZAPLICKI, G., TOUSSAINT, J.F., de CLERCG, K.,
DOCHY, J-M., DUFEY, J., GILLERMAN, J-L. & MESSEMAN, K. 2006
Bluetongue in northern Europe. The Veterinary Record, 159 : 327.
VENTER, G.J. 1991 ‘n Studie van die verspreiding en seisoenale voorkoms van
Culicoides spesies (Diptera: Ceratopogonidae) en gekoppelde virussiektes
in die R.S.A. MSc thesis University of the Orange Free State.
VENTER, G.J., GERDES, G.H., MELLOR, P.S. & PAWESKA, J.T. 2004
Transmission potential of South African Culicoides species for liveattenuated bluetongue virus. Veterinaria Italiana, 40: 198-203.
VENTER, G.J., GRAHAM, S.D. & HAMBLIN, C. 2000 African horse sickness
epidemiology: vector competence of South African Culicoides species for
virus serotypes 3, 5 and 8. Medical and Veterinary Entomology, 14: 245250.
VENTER, G.J., GROENEWALD. D.M., PAWESKA, J.T., VENTER, E.H. &
HOWELL. P.G. 1999 Vector competence of selected South African
Culicoides species for the Bryanston serotype of equine encephalosis virus.
Medical and Veterinary Entomology, 13: 393-400.
78
VENTER, G.J., GROENEWALD., D.M., VENTER, E.H., HERMANIDES, I &
HOWELL P.G. 2002 A comparison of the vector competence of the biting
midges, Culicoides (Avaritia) bolitinos and C. (A.) imicola for the Bryanston
serotype of equine encephalosis virus. Medical and Veterinary Entomology,
16: 372-377.
VENTER, G.J., KOEKEMOER, J.J.O. & PAWESKA, J.T. 2006b Investigations on
outbreaks of African horse sickness in the surveillance zone of South Africa
Revuescientifique et technique, Office International des Epizooties, 25 :
1 097-1109.
VENTER, G.J., LABUSCHAGNE, K., HERMANIDES, K.G., BOIKANYO, S.N.B.,
MAJATLADI, D.M. & MOREY, L. (in press) Comparison of the efficiency of
five suction light traps under field conditions in South Africa for the collection
of Culicoides species. Veterinary Parasitology.
VENTER, G.J., MELLOR, P.S. & PAWESKA, J.T. 2006a Oral susceptibility of
South African stock-associated Culicoides species to bluetongue virus.
Medical and Veterinary Entomology, 20: 329-334.
VENTER, G.J. & MEISWINKEL, R. 1994 The virtual absence of Culicoides
imicola (Diptera: Ceratopogonidae) in a light-trap survey of colder, high-lying
area of the eastern Orange Free State, South Africa, and implications for
the transmission of arboviruses. Onderstepoort Journal of Veterinary
Research, 61: 327-340.
VENTER, G.J., MELLOR, P.S., WRIGHT, I & PAWESKA, J.T. 2007 Replication
of live-attenuated vaccine strains in bluetongue virus in orally infected South
African Culicoides species. Medical and Veterinary Entomology, 21:239247.
79
VENTER, G.J, NEVILL, E.M. & VAN DER LINDE, T.C. De K. 1996 Geographical
distribution and relative abundance of stock associated Culicoides species
(Diptera: Ceratopogonidae) in South Africa in relation to their potential as
viral vectors. Onderstepoort Journal of Veterinary Research, 63: 25-38.
VENTER,
G.J.,
PAWESKA,
J.T.,
van
DIJK,
A.A.,
MELLOR,
P.S.
&
TABACHNICK, W.J. 1998 Vector competence of Culicoides bolitinos and C.
imicola (Diptera: Ceratopogonidae) for South African bluetongue virus
serotypes 1, 3 and 4. Medical and Veterinary Entomology, 12: 101-108.
VENTER, G.J., WRIGHT, I.M., VAN DER LINDE, T.C. & PAWESKA, J.T. 2009
The oral susceptibility of South African field population of Culicoides to
African horse sickness virus. Medical and Veterinary Entomology, 23: 367378.
VERWOERD, D.W. & ERASMUS, B.J. 2004 Bluetongue, in Infectious diseases
of livestock (ed. by J.A.W Coetzer and R.C Tustin), pp.1201 -1214. Oxford
University Press, Cape Town.
WATANABE, K.I., BESSHO, Y., KAWASAKI, M. & HORI, H. 1999 Mitochondrial
genes are found on minicircle DNA molecules in the mesozoan animal
Dicyema, Abstract. Journal of Molecular Biology, 286: 645 - 650.
WETZEL, H., NEVILL, E.M. & ERASMUS, B.J. 1970 Studies on the transmission
of African horsesickness. Onderstepoort Journal of Veterinary Research,
37:165-168.
80
WELLBY, M.P., BAYLIS, M., RAWLINGS, P. & MELLOR, P. 1996 Effect of
temperature on the rate of virogenesis of African horse sickness virus in
Culicoides (Diptera: Ceratopogonidae) and its significance in relation to the
epidemiology of the disease. Bulletin of Entomological Research, 86: 715720.
WIRTH, W.W. & HUBERT, A.A. 1989. The Culicoides of the southeast Asia
(Diptera: Ceratopogonidae). Memoirs of the America Entomological
Institute, Gainesville, USA.
WITTMANN, E.J., MELLOR, P.S. & BAYLIS, M. 2001 Using climate data to map
the potential distribution of Culicoides imicola (Diptera: Ceratopogonidae) in
Europe.
Revue
scientifque
et
technique,
Office
International
des
Epizoooties, 20: 731-740.
XIANG, B. & KOCHAR, T.D. 1991 Comparison of mitochondrial DNA sequences
of seven morphospecies of black flies (Dioptera). Genome, 34: 306-311.
81
Appendix 1
Multiple sequence alignment of the C. imicola and C. bolitinos nucleotide sequences of the COI
partial gene fragment for all individual midges used in this study. Culicoides tuttifrutti (TUT1)
sequence was used as a reference to generate the alignments. All the nucleotide sites that are
similar to TUT1 are represented by the dots. The alignment was used to compare the two species
of Culicoides. All the names of the sequences that were obtained from the GenBank start with
capital letters. The alignment was carried out using the Clustal X program. The prefix i represents
C. imicola and b represents C. bolitinos. The symbol (-) indicates deletions.
82
TUT1
IMI11
IMI15
IMI16
iOPV1
iOPV2
iOPV3
iOPV4
iOPV5
iOPV6
iKP3
iOPV8
iOPV9
iOPV10
iOPV11
iKP4
iOPV13
iOPV14
iOPV15
iOPV16
iKP1
iKP2
iSTELBea1
iSTELTri1
iSTELRiv1
iSTELWod1
iSTELBea2
iSTELTr2
iSTELRiv2
iSTELWod2
iSTELKun1
iSTELBon1
iSTELBon2
iSTELBon3
iSTELBon4
iSTELBon5
iSTELKen1
iSTELKen2
iSTELKen3
iSTELRob1
iSTELRob2
iSTELRob3
iSTELRob4
iSTELRob5
iUITWic1
iUITWic2
iUITWic3
iUITWic4
iUITWic5
iUITWic6
iUITWic7
iUITWic8
iUITWic9
iUITWic10
iUITWic11
iUITWic12
iUITWic13
SCON7
SCON9
ADC19
PEV1
IBET1
BOL14
BOL17
BOL20
BOL22
bCLA1
bCLA2
bCLA3
bCLA4
bCLA6
bCLA7
bCLA8
10
20
30
40
50
60
70
80
....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|
TTTAATATTAGGAGCTCCTGATATAGCTTTTCCTCGAATAAATAATATAAGATTTTGAATATTACCCCCTTCAATTACTT
A...........G......................................T..............G..A..T......C
A...........G......................................T..............G..A..T......C
A...........G......................................T..............G..A..T......C
A...........G......................................T..............G..A..T......C
A...........G......................................T..............G..A..T......C
A...........G......................................T..............G..A..T......C
A...........G......................................T..............G..A..T......C
A...........G......................................T..............G..A..T......C
A...........G......................................T..............G..A..T......C
A...........G......................................T..............G..A..T......C
A...........G......................................T..............G..A..T......C
A...........G......................................T..............G..A..T......C
A...........G......................................T..............G..A..T......C
A...........G......................................T..............G..A..T......C
A...........G......................................T..............G..A..T......C
A...........G......................................T..............G..A..T......C
A...........G......................................T..............G..A..T......C
A...........G......................................T..............G..A..T......C
A...........G......................................T..............G..A..T......C
A...........G......................................T..............G..A..T......C
A...........G......................................T..............G..A..T......C
A...........G......................................T..............G..A..T......C
A...........G......................................T..............G..A..T......C
A...........G......................................T..............G..A..T......C
A...........G......................................T..............G..A..T......C
A...........G......................................T..............G..A..T......C
A...........G......................................T..............G..A..T......C
A...........G......................................T..............G..A..T......C
A...........G......................................T..............G..A..T......C
A...........G......................................T..............G..A..T......C
A...........G......................................T..............G..A..T......C
A...........G......................................T..............G..A..T......C
A...........G......................................T..............G..A..T......C
A...........G......................................T..............G..A..T......C
A...........G......................................T..............G..A..T......C
A...........G......................................T..............G..A..T......C
A...........G......................................T..............G..A..T......C
A...........G......................................T..............G..A..T......C
A...........G......................................T..............G..A..T......C
A...........G......................................T..............G..A..T......C
A...........G...........G..........................T..............G..A..T......C
A...........G...........G..........................T..............G..A..T......C
A...........G...........G..........................T..............G..A..T......C
C...........G......................................T..............G..A..T......C
C...........G......................................T..............G..A..T......C
C...........G......................................T..............G..A..T......C
C...........G......................................T..............G..A..T......C
C...........G......................................T..............G..A..T......C
C...........G......................................T..............G..A..T......C
C...........G......................................T..............G..A..T......C
C...........G......................................T..............G..A..T......C
C...........G......................................T..............G..A..T......C
C...........G......................................T..............G..A..T......C
C...........G......................................T..............G..A..T......C
C...........G......................................T..............G..A..T......C
C...........G......................................T..............G..A..T......C
............G......................................T.................A..T.......
............G......................................T.................A..T......C
............G......................................T..............G..A..T......C
............G......................................T.................A..T.......
............G......................................T.................A..T......C
..............................C...................................T..G........A.
..............................C...................................T..G........A.
..............................C...................................T..G........A.
..............................C...................................T..G........A.
..............................C...................................T..G........A.
..............................C...................................T..G........A.
..............................C...................................T..G........A.
..............................C...................................T..A........A.
............G.....................................................T..A..........
............G.....................................................T..A..........
............G.....................................................T..A..........
83
bCLA9
bCLA10
bGEOOute1
bGEOKid1
bGEOKid2
bGEOKid3
bGEORid1
bGEORid2
bGEORid3
bGEORid4
bGEORid5
bGEORid6
bGEORid7
bGEORid8
bGEORid9
bSTELRob1
bSTELRob2
bSTELRob3
bSTELFar1
bSTELFar3
bSTELRos4
bSTELRos5
bSTELRos6
bSTELRos7
bSTELRos8
bSTELRos9
bSTELRos10
bSTELRos11
bPEAsc1
bPEAsc2
bPEAsc3
bPEAsc4
bPEAsc5
bPEAsc6
bPEAsc7
bPEAsc8
bPEAsc9
bPEAsc11
bPEAsc12
bPEAsc13
TUT3
TUT6
TUT7
..............................C...................................T..G........A.
..............................C...................................T..G........A.
....T...................G.....C...................................T..G........A.
A...........G.....................G...............................G..A..........
............G.....................................................T..A..........
............G.....................................................T..A..........
A...........G.....................G...............................G..A..........
A...........G.....................G...............................G..A..........
............G.....................................................T..A..........
A...........G.....................G...............................G..A..........
A...........G.....................G...............................G..A..........
............G.....................................................T..A..........
A...........G.....................G...............................G..A..........
............G.....................................................T..A..........
....T...................G.....C...................................T..G........A.
..............................C...................................T..G........A.
..............................C...................................T..G........A.
..............................C...................................T..G........A.
............G.....................................................T..A..........
A.................................................................T..A..........
..............................C...................................T..G........A.
............G.....................................................T..A..........
..............................C...................................T..G........A.
..............................C...................................T..G........A.
............G.....................................................T..A..........
..............................C...................................T..G........A.
..............................C...................................T..G........A.
..............................C...................................T..G........A.
..............................C...................................T..G........A.
..............................C...................................T..G........A.
..............................C...................................T..G........A.
............G.....................................................T..A..........
............G.....................................................T..A..........
A...........G.....................................................T..A..........
..............................C...................................T..G........A.
..............................C...................................T..G........A.
..............................C...................................T..G........A.
............G.....................................................T..A..........
............G.....................................................T..A..........
..............................C...................................T..G........A.
................................................................................
................................................................................
................................................................................
TUT1
IMI11
IMI15
IMI16
iOPV1
iOPV2
iOPV3
iOPV4
iOPV5
iOPV6
iKP3
iOPV8
iOPV9
iOPV10
iOPV11
iKP4
iOPV13
iOPV14
iOPV15
iOPV16
iKP1
iKP2
iSTELBea1
iSTELTri1
iSTELRiv1
iSTELWod1
iSTELBea2
iSTELTr2
iSTELRiv2
iSTELWod2
iSTELKun1
90
100
110
120
130
140
150
160
....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|
TACTTTTATTAAGTAGATTAGTAGAAAATGGAGCAGGGACAGGATGAACAGTTTACCCTCCTTTATCTGCAAATATTTCT
.T...................................A...........T.....T.....A.....A......G.....
.T...................................A...........T.....T.....A.....A......G.....
.T...................................A...........T.....T.....A.....A......G.....
.T...................................A...........T.....T.....A.....A......G.C...
.T...................................A...........T.....T.....A.....A......G.C...
.T...................................A...........T.....T.....A.....A......G.C...
.T...................................A...........T.....T.....A.....A......G.C...
.T...................................A...........T.....T.....A.....A......G.....
.T...................................A...........T.....T.....A.....A......G.C...
.T...................................A...........T.....T.....A.....A......G.....
.T...................................A...........T.....T.....A.....A......G.....
.T...................................A...........T.....T.....A.....A......G.C...
.T...................................A...........T.....T.....A.....A......G.....
.T...................................A...........T.....T.....A.....A......G.....
.T...................................A...........T.....T.....A.....A......G.....
.T...................................A...........T.....T.....A.....A......G.C...
.T...................................A...........T.....T.....A.....A......G.....
.T...................................A...........T.....T.....A.....A......G.C...
.T...................................A...........T.....T.....A.....A......G.....
.T...................................A...........T.....T.....A.....A......G.....
.T...................................A...........T.....T.....A.....A......G.....
.T...................................A...........T.....T.....A.....A......G.C...
.T...................................A...........T.....T.....A.....A......G.C...
.T...................................A...........T.....T.....A.....A......G.....
.T...................................A...........T.....T.....A.....A......G.C...
.T...................................A...........T.....T.....A.....A......G.C...
.T...................................A...........T.....T.....A.....A......G.C...
.T...................................A...........T.....T.....A.....A......G.C...
.T...................................A...........T.....T.....A.....A......G.C...
.T...................................A...........T.....T.....A.....A......G.C...
84
iSTELBon1
iSTELBon2
iSTELBon3
iSTELBon4
iSTELBon5
iSTELKen1
iSTELKen2
iSTELKen3
iSTELRob1
iSTELRob2
iSTELRob3
iSTELRob4
iSTELRob5
iUITWic1
iUITWic2
iUITWic3
iUITWic4
iUITWic5
iUITWic6
iUITWic7
iUITWic8
iUITWic9
iUITWic10
iUITWic11
iUITWic12
iUITWic13
SCON7
SCON9
ADC19
PEV1
IBET1
BOL14
BOL17
BOL20
BOL22
bCLA1
bCLA2
bCLA3
bCLA4
bCLA6
bCLA7
bCLA8
bCLA9
bCLA10
bGEOOute1
bGEOKid1
bGEOKid2
bGEOKid3
bGEORid1
bGEORid2
bGEORid3
bGEORid4
bGEORid5
bGEORid6
bGEORid7
bGEORid8
bGEORid9
bSTELRob1
bSTELRob2
bSTELRob3
bSTELFar1
bSTELFar3
bSTELRos4
bSTELRos5
bSTELRos6
bSTELRos7
bSTELRos8
bSTELRos9
bSTELRos10
bSTELRos11
bPEAsc1
bPEAsc2
bPEAsc3
bPEAsc4
bPEAsc5
bPEAsc6
bPEAsc7
.T...................................A...........T.....T.....A.....A......G.C...
.T...................................A...........T.....T.....A.....A......G.C...
.T...................................A...........T.....T.....A.....A......G.C...
.T...................................A...........T.....T.....A.....A......G.....
.T...................................A...........T.....T.....A.....A......G.C...
.T...................................A...........T.....T.....A.....A......G.C...
.T...................................A...........T.....T.....A.....A......G.....
.T...................................A...........T.....T.....A.....A......G.C...
.T...................................A...........T.....T.....A.....A......G.C...
.T...................................A...........T.....T.....A.....A......G.....
.T...................................A...........T.....T.....A.....A......G.C...
.T...................................A...........T.....T.....A.....A......G.....
.T...................................A...........T.....T.....A.....A......G.C...
.T...................................A...........T.....T.....A.....A......G.....
.T...................................A...........T.....T.....A.....A......G.....
.T...................................A...........T.....T.....A.....A......G.....
.T...................................A...........T.....T.....A.....A......G.....
.T...................................A...........T.....T.....A.....A......G.....
.T...................................A...........T.....T.....A.....A......G.....
.T...................................A...........T.....T.....A.....A......G.....
.T...................................A...........T.....T.....A.....A......G.....
.T...................................A...........T.....T.....A.....A......G.....
.T...................................A...........T.....T.....A.....A......G.....
.T...................................A...........T.....T.....A.....A......G.....
.T...................................A...........T.....T.....A.....A......G.....
.T...................................A...........T.....T.....A.....A......G.....
.T...................................A...........T.....T.....A.....A......G.C...
.T...................................A...........T.....T.....A.....A......G.C...
.T...................................A...........T.....T.....A.....A......G.C...
.T...................................A...........T.....T.....A.....A......G.C...
.T...................................A...........T.....T.....A.....A......G.C...
.............A..............C..G.....A........G.....................T.T...G.....
.............A..............C..G.....A........G.....................T.T...G.....
.............A..............C..G.....A........G.....................T.T...G.....
.............A..............C..G.....A........G.....................T.T...G.....
.............A..............C..G.....A........G.....................T.T...G.....
.............A..............C..G.....A........G.....................T.T...G.....
.............A..............C..G.....A........G.....................T.T...G.....
.............A..............C..G.....A........G.....................T.....G.....
.............A..............C..G.....A........G.....................T.....G.....
.............A..............C..G.....A........G.....................T.....G.....
.............A..............C..G.....A........G.....................T.....G.....
.............A..............C..G.....A........G.....................T.T...G.....
.............A..............C..G.....A........G.....................T.T...G.....
.............A..............C..G.....A........G.....................T.T...G.....
.T...........A..............C..G.....A........G........T...........AT.....G.....
.TT..........A..............C..G.....A........G.....................T.....G.....
.C...........A..............C..G.....A........G.....................T.....G.....
.T...........A..............C..G.....A........G........T...........AT.....G.....
.T...........A..............C..G.....A........G........T...........AT.....G.....
.TT..........A..............C..G.....A........G.....................T.....G.....
.T...........A..............C..G.....A........G........T...........AT.....G.....
.T...........A..............C..G.....A........G........T...........AT.....G.....
.TT..........A..............C..G.....A........G.....................T.....G.....
.T...........A..............C..G.....A........G........T...........AT.....G.....
.C...........A..............C..G.....A........G.....................T.....G.....
.............A..............C..G.....A........G.....................T.T...G.....
.............A..............C..G.....A........G.....................T.T...G.....
.............A..............C..G.....A........G.....................T.T...G.....
.............A..............C..G.....A........G.....................T.T...G.....
.T...........A..............C..G.....A........G.....................T.....G.....
.T...........A..............C..G.....A...........T.....T...........G......G.....
.............A..............C..G.....A........G.....................T.T...G.....
.T...........A..............C..G.....A........G.....................T.....G.....
.............A..............C..G.....A........G.....................T.T...G.....
.............A..............C..G.....A........G.....................T.T...G.....
.T...........A..............C..G.....A........G.....................T.....G.....
.............A..............C..G.....A........G.....................T.T...G.....
.............A..............C..G.....A........G.....................T.T...G.....
.............A..............C..G.....A........G.....................T.T...G.....
.............A..............C..G.....A........G.....................T.T...G.....
.............A..............C..G.....A........G.....................T.T...G.....
.............A..............C..G.....A........G.....................T.T...G.....
.T...........A..............C..G.....A........G....................AA.....G.....
.T...........A..............C..G.....A........G.....................T.....G.....
.T...........A..............C..G.....A........G.....................T.....G.C...
.............A..............C..G.....A........G.....................T.T...G.....
85
bPEAsc8
bPEAsc9
bPEAsc11
bPEAsc12
bPEAsc13
TUT3
TUT6
TUT7
.............A..............C..G.....A........G.....................T.T...G.....
.............A..............C..G.....A........G.....................T.T...G.....
.T...........A..............C..G.....A........G....................AA.....G.....
.T...........A..............C..G.....A........G.....................T.....G.....
.............A..............C..G.....A........G.....................T.T...G.....
................................................................................
................................................................................
................................................................................
TUT1
IMI11
IMI15
IMI16
iOPV1
iOPV2
iOPV3
iOPV4
iOPV5
iOPV6
iKP3
iOPV8
iOPV9
iOPV10
iOPV11
iKP4
iOPV13
iOPV14
iOPV15
iOPV16
iKP1
iKP2
iSTELBea1
iSTELTri1
iSTELRiv1
iSTELWod1
iSTELBea2
iSTELTr2
iSTELRiv2
iSTELWod2
iSTELKun1
iSTELBon1
iSTELBon2
iSTELBon3
iSTELBon4
iSTELBon5
iSTELKen1
iSTELKen2
iSTELKen3
iSTELRob1
iSTELRob2
iSTELRob3
iSTELRob4
iSTELRob5
iUITWic1
iUITWic2
iUITWic3
iUITWic4
iUITWic5
iUITWic6
iUITWic7
iUITWic8
iUITWic9
iUITWic10
iUITWic11
iUITWic12
iUITWic13
SCON7
SCON9
ADC19
PEV1
IBET1
BOL14
BOL17
BOL20
BOL22
170
180
190
200
210
220
230
240
....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|
CATGCTGGTGCTTCTGTTGATTTAGCAATTTTTTCTTTACATTTAGCAGGAATTAGATCTATTTTAGGAGCTGTAAATTT
........A.....A...........T.....C..............T..G.....T..A........T...........
........A.....A...........T.....C..............T..G.....T..A........T...........
........A.....A...........T.....C..............T..G.....T..A........T...........
........A.....A...........T.....C..............T..G.....T..A........T...........
........A.....A...........T.....C..............T..G.....T..A........T...........
........A.....A...........T.....C..............T..G.....T..A........T...........
........A.....A...........T.....C..............T..G.....T..A........T...........
........A.....A...........T.....C..............T..G.....T..A........T...........
........A.....A...........T.....C..............T..G.....T..A........T...........
........A.....A...........T.....C..............T..G.....T..A........T...........
........A.....A...........T.....C..............T..G.....T..A........T...........
........A.....A...........T.....C..............T..G.....T..A........T...........
........A.....A...........T.....C..............T..G.....T..A........T...........
........A.....A...........T.....C..............T..G.....T..A........T...........
........A.....A...........T.....C..............T..G.....T..A........T...........
........A.....A...........T.....C..............T..G.....T..A........T...........
........A.....A...........T.....C..............T..G.....T..A........T...........
........A.....A...........T.....C..............T..G.....T..A........T...........
........A.....A...........T.....C..............T..G.....T..A........T...........
........A.....A...........T.....C..............T..G.....T..A........T...........
........A.....A...........T.....C..............T..G.....T..A........T...........
........A.....A...........T.....C..............T..G.....T..A........T...........
........A.....A...........T.....C..............T..G.....T..A........T...........
........A.....A...........T.....C..............T..G.....T..A........T...........
........A.....A...........T.....C..............T..G.....T..A........T...........
........A.....A...........T.....C..............T..G.....T..A........T...........
........A.....A...........T.....C..............T..G.....T..A........T...........
........A.....A...........T.....C..............T..G.....T..A........T...........
........A.....A...........T.....C..............T..G.....T..A........T...........
........A.....A...........T.....C..............T..G.....T..A........T...........
........A.....A...........T.....C..............T..G.....T..A........T...........
........A.....A...........T.....C..............T..G.....T..A........T...........
........A.....A...........T.....C..............T..G.....T..A........T...........
........A.....A...........T.....C..............T..G.....T..A........T...........
........A.....A...........T.....C..............T..G.....T..A........T...........
........A.....A...........T.....C..............T..G.....T..A........T...........
........A.....A...........T.....C..............T..G.....T..A........T...........
........A.....A...........T.....C..............T..G.....T..A........T...........
........A.....A...........T.....C..............T..G.....T..A........T...........
........A.....A...........T.....C..............T..G.....T..A........T...........
........A.....A...........T.....C..............T..G.....T..A........T...........
........A.....A...........T.....C..............T..G.....T..A........T...........
........A.....A...........T.....C..............T..G.....T..A........T...........
........A.....A...........T.....C..............T..G.....T..A........T...........
...T....A.....A...........T.....C..............T..G.....T..A........T...........
...T....A.....A...........T.....C..............T..G.....T..A........T...........
........A.....A...........T.....C..............T..G.....T..A........T...........
........A.....A...........T.....C..............T..G.....T..A........T...........
........A.....A...........T.....C..............T..G.....T..A........T...........
........A.....A...........T.....C..............T..G.....T..A........T...........
........A.....A...........T.....C..............T..G.....T..A........T...........
...T....A.....A...........T.....C..............T..G.....T..A........T...........
........A.....A...........T.....C..............T..G.....T..A........T...........
........A.....A...........T.....C..............T..G.....T..A........T...........
........A.....A...........T.....C..............T..G.....T..A........T...........
........A.....A...........T.....C..............T..G.....T..A........T...........
........A.....A...........T.....C..............T..G.....T..A........T...........
........A.....A...........T.....C..............T..G.....T..A........T...........
........A.....A...........T.....C..............T..G.....T..A........T...........
........A.....A...........T.....C..............T..G.....T..A........T...........
........A.....A...........T.....C..............T..G.....T..A........T...........
........A.................T....................C..G........A........G...........
........A.................T....................C..G........A........G...........
........A.................T....................C..G........A........G...........
........A.................T....................C..G........A........G...........
86
bCLA1
bCLA2
bCLA3
bCLA4
bCLA6
bCLA7
bCLA8
bCLA9
bCLA10
bGEOOute1
bGEOKid1
bGEOKid2
bGEOKid3
bGEORid1
bGEORid2
bGEORid3
bGEORid4
bGEORid5
bGEORid6
bGEORid7
bGEORid8
bGEORid9
bSTELRob1
bSTELRob2
bSTELRob3
bSTELFar1
bSTELFar3
bSTELRos4
bSTELRos5
bSTELRos6
bSTELRos7
bSTELRos8
bSTELRos9
bSTELRos10
bSTELRos11
bPEAsc1
bPEAsc2
bPEAsc3
bPEAsc4
bPEAsc5
bPEAsc6
bPEAsc7
bPEAsc8
bPEAsc9
bPEAsc11
bPEAsc12
bPEAsc13
TUT3
TUT6
TUT7
........A.................T....................C..G........A........G...........
........A.................T....................C..G........A........G...........
........A.................T....................C..G........A........G...........
........A.................T....................C..G........A........G...........
........A.................T....................C..G........A........G...........
........A.................T....................C..G........A........G...........
........A.................T....................C..G........A........G...........
........A.................T....................C..G........A........G...........
........A.................T....................C..G........A........G...........
........A.................T....................C..G........A........G...........
........A.....A...........T.....C..............C..G........A........G...........
........A.....A...........T.....C..............C..G........A........G...........
........A.....A...........T.....C..............C..G........A........G...........
........A.....A...........T.....C..............C..G........A........G...........
........A.....A...........T.....C..............C..G........A........G...........
........A.....A...........T.....C..............C..G........A........G...........
........A.....A...........T.....C..............C..G........A........G...........
........A.....A...........T.....C..............C..G........A........G...........
........A.....A...........T.....C..............C..G........A........G...........
........A.....A...........T.....C..............C..G........A........G...........
........A.....A...........T.....C..............C..G........A........G...........
........A.................T....................C..G........A........G...........
........A.................T....................C..G........A........G...........
........A.................T....................C..G........A........G...........
........A.................T....................C..G........A........G...........
........A.....A...........T....................C..G........A........G...........
........A.....A...........T....................C..G........A........G...........
........A.................T....................C..G........A........G...........
........A.....A...........T....................C..G........A........G...........
........A.................T....................C..G........A........G...........
........A.................T....................C..G........A........G...........
........A.....A...........T....................C..G........A........G...........
........A.................T....................C..G........A........G...........
........A.................T....................C..G........A........G...........
........A.................T....................C..G........A........G...........
........A.................T....................C..G........A........G...........
........A.................T....................C..G........A........G...........
........A.................T....................C..G........A........G...........
........A.....A...........T.....C..............C..G........A........G...........
........A.....A...........T....................C..G........A........G...........
........A.....A...........T.....C..............C..G........A........G...........
........A.................T....................C..G........A........G...........
........A.................T....................C..G........A........G...........
........A.................T....................C..G........A........G...........
........A.....A...........T.....C..............C..G........A........G...........
........A.....A...........T....................C..G........A........G...........
........A.................T....................C..G........A........G...........
................................................................................
................................................................................
................................................................................
TUT1
IMI11
IMI15
IMI16
iOPV1
iOPV2
iOPV3
iOPV4
iOPV5
iOPV6
iKP3
iOPV8
iOPV9
iOPV10
iOPV11
iKP4
iOPV13
iOPV14
iOPV15
iOPV16
iKP1
iKP2
iSTELBea1
iSTELTri1
250
260
270
280
290
300
310
320
....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|
TATTACTACTATTATTAATATACGACCAATAGGAATATCTTTAGATCGAATGCCTTTATTTGTTTGATCAGTATTAATTA
......A..A..............T..TGA.......A..A.G........A.......................T....
......A..A..............T..TGA.......A..A.G........A.......................T....
......A..A..............T..TGA.......A..A.G........A.......................T....
......A..A..............T..TGA.......A..A.G........A.......................T....
......A..A..............T..TGA.......A..A.G........A.......................T....
......A..A..............T..TGA.......A..A.G........A.......................T....
......A..A..............T..TGA.......A..A.G........A.......................T....
......A..A..............T..TGA.......A..A.G........A.......................T....
......A..A..............T..TGA.......A..A.G........A.......................T....
......A..A..............T..TGA.......A..A.G........A.......................T....
......A..A..............T..TGA.......A..A.G........A.......................T....
......A..A..............T..TGA.......A..A.G........A.......................T....
......A..A..............T..TGA.......A..A.G........A.......................T....
......A..A..............T..TGA.......A..A.G........A.......................T....
......A..A..............T..TGA.......A..A.G........A.......................T....
......A..A..............T..TGA.......A..A.G........A.......................T....
......A..A..............T..TGA.......A..A.G........A.......................T....
......A..A..............T..TGA.......A..A.G........A.......................T....
......A..A..............T..TGA.......A..A.G........A.......................T....
......A..A..............T..TGA.......A..A.G........A.......................T....
......A..A..............T..TGA.......A..A.G........A.......................T....
......A..A..............T..TGA.......A..A.G........A.......................T....
......A..A..............T..TGA.......A..A.G........A.......................T....
87
iSTELRiv1
iSTELWod1
iSTELBea2
iSTELTr2
iSTELRiv2
iSTELWod2
iSTELKun1
iSTELBon1
iSTELBon2
iSTELBon3
iSTELBon4
iSTELBon5
iSTELKen1
iSTELKen2
iSTELKen3
iSTELRob1
iSTELRob2
iSTELRob3
iSTELRob4
iSTELRob5
iUITWic1
iUITWic2
iUITWic3
iUITWic4
iUITWic5
iUITWic6
iUITWic7
iUITWic8
iUITWic9
iUITWic10
iUITWic11
iUITWic12
iUITWic13
SCON7
SCON9
ADC19
PEV1
IBET1
BOL14
BOL17
BOL20
BOL22
bCLA1
bCLA2
bCLA3
bCLA4
bCLA6
bCLA7
bCLA8
bCLA9
bCLA10
bGEOOute1
bGEOKid1
bGEOKid2
bGEOKid3
bGEORid1
bGEORid2
bGEORid3
bGEORid4
bGEORid5
bGEORid6
bGEORid7
bGEORid8
bGEORid9
bSTELRob1
bSTELRob2
bSTELRob3
bSTELFar1
bSTELFar3
bSTELRos4
bSTELRos5
bSTELRos6
bSTELRos7
bSTELRos8
bSTELRos9
bSTELRos10
bSTELRos11
......A..A..............T..TGA.......A..A.G........A.......................T....
......A..A..............T..TGA.......A..A.G........A.......................T....
......A..A..............T..TGA.......A..A.G........A.......................T....
......A..A..............T..TGA.......A..A.G........A.......................T....
......A..A..............T..TGA.......A..A.G........A.......................T....
......A..A..............T..TGA.......A..A.G........A.......................T....
......A..A..............T..TGA.......A..A.G........A.......................T....
......A..A..............T..TGA.......A..A.G........A.......................T....
......A..A..............T..TGA.......A..A.G........A.......................T....
......A..A..............T..TGA.......A..A.G........A.......................T....
......A..A..............T..TGA.......A..A.G........A.......................T....
......A..A..............T..TGA.......A..A.G........A.......................T....
......A..A..............T..TGA.......A..A.G........A.......................T....
......A..A..............T..TGA.......A..A.G........A.......................T....
......A..A..............T..TGA.......A..A.G........A.......................T....
......A..A..............T..TGA.......A..A.G........A.......................T....
......A..A..............T..TGA.......A..A.G........A.......................T....
......A..A..............T..TGA.......A..A.G........A.......................T....
......A..A..............T..TGA.......A..A.G........A.......................T....
......A..A..............T..TGA.......A..A.G........A.......................T....
......A..A..............T..TGA.......A..A.G........A.......................T....
......A..A..............T..TGA.......A..A.G........A.......................T....
......A..A..............T..TGA.......A..A.G........A.......................T....
......A..A..............T..TGA.......A..A.G........A.......................T....
......A..A..............T..TGA.......A..A.G........A.......................T....
......A..A..............T..TGA.......A..A.G........A.......................T....
......A..A..............T..TGA.......A..A.G........A.......................T....
......A..A..............T..TGA.......A..A.G........A.......................T....
......A..A..............T..TGA.......A..A.G........A.......................T....
......A..A..............T..TGA.......A..A.G........A.......................T....
......A..A..............T..TGA.......A..A.G........A.......................T....
......A..A..............T..TGA.......A..A.G........A.......................T....
......A..A..............T..TGA.......A..A.G........A.......................T....
......A..A..............T..TGA.......A..A.G........A.......................T....
......A..A..............T..TGA.......A..A.G........A.......................T....
......A..A..............T..TGA.......A..A.G........A.......................T....
......A..A..............T..TGA.......A..A.G........A.......................T....
......A..A..............T..TGA.......A..A.G........A.......................T....
............................G........A.............A....................G...C.A.
............................G........A.............A....................G...C.A.
............................G........A.............A....................G...C.A.
............................G........A.............A....................G...C.A.
............................G........A.............A....................G...C.A.
............................G........A.............A....................G...C.A.
............................G........A.............A....................G...C.A.
............................G........A.............A....................G...C.A.
............................G........A....G........A....................G...C.A.
............................G........A....G........A....................G...C.A.
............................G........A....G........A....................G...C.A.
............................G........A.............A....................G...C.A.
............................G........A.............A....................G...C.A.
............................G........A.............A....................G...C.A.
.........A..................GA.......A....G........A....................G...C.A.
............................GA.......A....G........A....................G...C.A.
............................G........A.............A....................G...C.A.
.........A..................GA.......A....G........A....................G...C.A.
.........A..................GA.......A....G........A....................G...C.A.
............................GA.......A....G........A....................G...C.A.
.........A..................GA.......A....G........A....................G...C.A.
.........A..................GA.......A....G........A....................G...C.A.
............................GA.......A....G........A....................G...C.A.
.........A..................GA.......A....G........A....................G...C.A.
............................G........A.............A....................G...C.A.
............................G........A.............A....................G...C.A.
............................G........A.............A....................G...C.A.
............................G........A.............A....................G...C.A.
............................G........A.............A....................G...C.A.
............................G........A.............A....................G...C.A.
.........A..................G........A..A..........A....................G...C.A.
............................G........A.............A....................G...C.A.
............................G........A.............A....................G...C.A.
............................G........A.............A....................G...C.A.
............................G........A.............A....................G...C.A.
............................G........A.............A....................G...C.A.
............................G........A.............A....................G...C.A.
............................G........A.............A....................G...C.A.
............................G........A.............A....................G...C.A.
88
bPEAsc1
bPEAsc2
bPEAsc3
bPEAsc4
bPEAsc5
bPEAsc6
bPEAsc7
bPEAsc8
bPEAsc9
bPEAsc11
bPEAsc12
bPEAsc13
TUT3
TUT6
TUT7
............................G........A.............A....................G...C.A.
............................G........A.............A....................G...T.A.
............................G........A.............A....................G...C.A.
........................T...GA.......A..A.G........A....................G...C.A.
............................GA.......A....G........A....................G...C.A.
............................G........A..A.G........A....................G...C.A.
............................G........A.............A....................G...T.A.
............................G........A.............A....................G...C.A.
............................G........A.............A....................G...C.A.
........................T...GA.......A..A.G........A....................G...C.A.
............................GA.......A....G........A....................G...C.A.
............................G........A.............A....................G...C.A.
................................................................................
................................................................................
................................................................................
TUT1
IMI11
IMI15
IMI16
iOPV1
iOPV2
iOPV3
iOPV4
iOPV5
iOPV6
iKP3
iOPV8
iOPV9
iOPV10
iOPV11
iKP4
iOPV13
iOPV14
iOPV15
iOPV16
iKP1
iKP2
iSTELBea1
iSTELTri1
iSTELRiv1
iSTELWod1
iSTELBea2
iSTELTr2
iSTELRiv2
iSTELWod2
iSTELKun1
iSTELBon1
iSTELBon2
iSTELBon3
iSTELBon4
iSTELBon5
iSTELKen1
iSTELKen2
iSTELKen3
iSTELRob1
iSTELRob2
iSTELRob3
iSTELRob4
iSTELRob5
iUITWic1
iUITWic2
iUITWic3
iUITWic4
iUITWic5
iUITWic6
iUITWic7
iUITWic8
iUITWic9
iUITWic10
iUITWic11
iUITWic12
iUITWic13
SCON7
SCON9
330
340
350
360
370
380
390
400
....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|
CAGCAATTTTATTATTGTTATCATTACCTGTTTTAGCTGGTGCTATTACAATATTATTAACTGATCGAAATATTAATACT
....T.........C.T.....T........G.....A..G........T...........A.....G............
....T.........C.T.....T........G.....A..G........T...........A.....G............
....T.........C.T.....T........G.....A..G........T...........A.....G............
....T.........C.T.....T........G.....A..G....................A.....G............
....T.........C.T.....T........G.....A..G....................A.....G............
....T.........C.T.....T........G.....A..G....................A.....G............
....T.........C.T.....T........G.....A..G....................A.....G............
....T.........C.T.....T........G.....A..G....................A.....G............
....T.........C.T.....T........G.....A..G....................A.....G............
....T.........C.T.....T........G.....A..G....................A.....G............
....T.........C.T.....T........G.....A..G....................A.....G............
....T.........C.T.....T........G.....A..G....................A.....G............
....T.........C.T.....T........G.....A..G....................A.....G............
....T.........C.T.....T........G.....A..G....................A.....G............
....T.........C.T.....T........G.....A..G....................A.....G............
....T.........C.T.....T........G.....A..G....................A.....G............
....T.........C.T.....T........G.....A..G....................A.....G............
....T.........C.T.....T........G.....A..G....................A.....G............
....T.........C.T.....T........G.....A..G....................A.....G............
....T.........C.T.....T........G.....A..G....................A.....G............
....T.........C.T.....T........G.....A..G....................A.....G............
....T.........C.T.....T........G.....A..G....................A.....G............
....T.........C.T.....T........G.....A..G....................A.....G............
....T.........C.T.....T........G.....A..G....................A.....G............
....T.........C.T.....T........G.....A..G....................A.....G............
....T.........C.T.....T........G.....A..G....................A.....G............
....T.........C.T.....T........G.....A..G....................A.....G............
....T.........C.T.....T........G.....A..G....................A.....G............
....T.........C.T.....T........G.....A..G....................A.....G............
....T.........C.T.....T........G.....A..G....................A.....G............
....T.........C.T.....T........G.....A..G....................A.....G............
....T.........C.T.....T........G.....A..G....................A.....G............
....T.........C.T.....T........G.....A..G....................A.....G............
....T.........C.T.....T........G.....A..G....................A.....G............
....T.........C.T.....T........G.....A..G....................A.....G............
....T.........C.T.....T........G.....A..G....................A.....G............
....T.........C.T.....T........G.....A..G....................A.....G............
....T.........C.T.....T........G.....A..G....................A.....G............
....T.........C.T.....T........G.....A..G....................A.....G............
....T.........C.T.....T........G.....A..G....................A.....G............
....T.........C.T.....T........G.....A..G....................A.....G............
....T.........C.T.....T........G.....A..G....................A.....G............
....T.........C.T.....T........G.....A..G....................A.....G............
....T.........C.T.....T........G.....A..G....................A.....G............
....T.........C.T.....T........G.....A..G....................A.....G............
....T.........C.T.....T........G.....A..G....................A.....G............
....T.........C.T.....T........G.....A..G....................A.....G............
....T.........C.T.....T........G.....A..G....................A.....G............
....T.........C.T.....T........G.....A..G....................A.....G............
....T.........C.T.....T........G.....A..G....................A.....G............
....T.........C.T.....T........G.....A..G....................A.....G............
....T.........C.T.....T........G.....A..G....................A.....G............
....T.........C.T.....T........G.....A..G....................A.....G............
....T.........C.T.....T........G.....A..G....................A.....G............
....T.........C.T.....T........G.....A..G....................A.....G............
....T.........C.T.....T........G.....A..G....................A.....G............
....T.........C.T.....T........G.....A..G....................A.....G............
....T.........C.AC....TC.......G.....A..G....................A.....G............
89
ADC19
PEV1
IBET1
BOL14
BOL17
BOL20
BOL22
bCLA1
bCLA2
bCLA3
bCLA4
bCLA6
bCLA7
bCLA8
bCLA9
bCLA10
bGEOOute1
bGEOKid1
bGEOKid2
bGEOKid3
bGEORid1
bGEORid2
bGEORid3
bGEORid4
bGEORid5
bGEORid6
bGEORid7
bGEORid8
bGEORid9
bSTELRob1
bSTELRob2
bSTELRob3
bSTELFar1
bSTELFar3
bSTELRos4
bSTELRos5
bSTELRos6
bSTELRos7
bSTELRos8
bSTELRos9
bSTELRos10
bSTELRos11
bPEAsc1
bPEAsc2
bPEAsc3
bPEAsc4
bPEAsc5
bPEAsc6
bPEAsc7
bPEAsc8
bPEAsc9
bPEAsc11
bPEAsc12
bPEAsc13
TUT3
TUT6
TUT7
....T.........C.T.....T........G.....A..G....................A.....G............
....T.........C.C.....TC.......G.....A..G....................A.....G............
....T.........C.T.....T........G.....A..G....................A.....G............
....T........G..A...........A........A..A........T........G...........C.........
....T........G..A...........A........A..A........T........G...........C.........
....T........G..A...........A........A..A........T........G...........C.........
....T........G..A...........A........A..A........T........G...........C.........
....T........G..A...........A........A..A........T........G...........C.........
....T........G..A...........A........A..A........T........G...........C.........
....T........G..A...........A........A..A........T........G...........C.........
....T........G..A...........A........A..A........T........G...........C.........
....T........GC.A...........A..G.....A..A........T........G........G..C.........
....T........GC.A...........A..G.....A..G........T........G........G..C.........
....T........GC.A...........A..G.....A..A........T........G........G..C.........
....T........G..A...........A........A..A........T........G...........C.........
....T........G..A...........A........A..A........T........G...........C.........
....T........G..A...........A........A..A........T........G...........C.........
....T........GC.A...........A..G.....A..G........T........G...........C.........
....T........GC.A...........A..G.....A..A........T........G........G..C.........
....T........GC.A...........A..G.....A..A........T........G........G..C.........
....T........GC.A...........A..G.....A..G........T........G...........C.........
....T........GC.A...........A..G.....A..G........T........G...........C.........
....T........GC.A...........A..G.....A..A........T........G........G..C.........
....T........GC.A...........A..G.....A..G........T........G...........C.........
....T........GC.A...........A..G.....A..G........T........G...........C.........
....T........GC.A...........A..G.....A..A........T........G........G..C.........
....T........GC.A...........A..G.....A..G........T........G...........C.........
....T........GC.A...........A..G.....A..A........T........G........G..C.........
....T........G..A...........A........A..A........T........G...........C.........
....T........G..A...........A........A..A........T........G...........C.........
....T........G..A...........A........A..A........T........G...........C.........
....T........G..A...........A........A..A........T........G...........C.........
....T........GC.A...........A..G.....A..A........T........G...........C.........
....T........GC.A...........A..G.....A..G........T........G...........C.........
....T........G..A...........A........A..A........T........G...........C.........
....T........GC.A...........A..G.....A..A........T........G...........C.........
....T........G..A...........A........A..A........T........G...........C.........
....T........G..A...........A........A..A........T........G...........C.........
....T........GC.A...........A..G.....A..A........T........G...........C.........
....T........G..A...........A........A..A........T........G...........C.........
....T........G..A...........A........A..A........T........G...........C.........
....T........G..A...........A........A..A........T........G...........C.........
....T........G..A...........A........A..A........T........G...........C.........
....T........G..A...........A........A..A........T........G...........C.........
....T........G..A...........A........A..A........T........G...........C.........
....T........GC.A...........A..G.....A..G........T........G........G..C.........
....T........GC.A...........A..G.....A..G........T........G...........C.........
....T........GC.A...........A..G.....A..A........T........G...........C.........
....T........G..A...........A........A..A........T........G...........C.........
....T........G..A...........A........A..A........T........G...........C.........
....T........G..A...........A........A..A........T........G...........C.........
....T........GC.A...........A..G.....A..G........T........G........G..C.........
....T........GC.A...........A..G.....A..G........T........G...........C.........
....T........G..A...........A........A..A........T........G...........C.........
................................................................................
................................................................................
................................................................................
TUT1
IMI11
IMI15
IMI16
iOPV1
iOPV2
iOPV3
iOPV4
iOPV5
iOPV6
iKP3
iOPV8
iOPV9
iOPV10
iOPV11
iKP4
iOPV13
410
420
430
440
450
460
470
480
....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|
TCATTTTTTGATCCTGCAGGAGGGGGGGATCCAATTTTATATCAACATTTATTTTGATTTTTTGGTCATCCA-------..C........C..A........A..A.....T........C.......................G......-------..C........C..A........A..A.....T........C.......................G......-------..C........C..A........A..A.....T........C.......................G......-------..C...........A...........A.....T........C.......................G..C...-------..C...........A...........A.....T........C.......................G..C...-------..C...........A...........A.....T........C.......................G..C...-------..C...........A...........A.....T........C.......................G..C...-------..C........C..A...........A.....T........C.......................G......-------..C...........A...........A.....T........C.......................G......-------..C........C..A...........A.....T........C.......................G......-------..C........C..A...........A.....T........C.......................G......-------..C...........A...........A.....T........C.......................G..C...-------..C........C..A...........A.....T........C.......................G......-------..C........C..A...........A.....T........C.......................G......-------..C........C..A...........A.....T........C.......................G......-------..C...........A...........A.....T........C.......................G..C...--------
90
iOPV14
iOPV15
iOPV16
iKP1
iKP2
iSTELBea1
iSTELTri1
iSTELRiv1
iSTELWod1
iSTELBea2
iSTELTr2
iSTELRiv2
iSTELWod2
iSTELKun1
iSTELBon1
iSTELBon2
iSTELBon3
iSTELBon4
iSTELBon5
iSTELKen1
iSTELKen2
iSTELKen3
iSTELRob1
iSTELRob2
iSTELRob3
iSTELRob4
iSTELRob5
iUITWic1
iUITWic2
iUITWic3
iUITWic4
iUITWic5
iUITWic6
iUITWic7
iUITWic8
iUITWic9
iUITWic10
iUITWic11
iUITWic12
iUITWic13
SCON7
SCON9
ADC19
PEV1
IBET1
BOL14
BOL17
BOL20
BOL22
bCLA1
bCLA2
bCLA3
bCLA4
bCLA6
bCLA7
bCLA8
bCLA9
bCLA10
bGEOOute1
bGEOKid1
bGEOKid2
bGEOKid3
bGEORid1
bGEORid2
bGEORid3
bGEORid4
bGEORid5
bGEORid6
bGEORid7
bGEORid8
bGEORid9
bSTELRob1
bSTELRob2
bSTELRob3
bSTELFar1
bSTELFar3
bSTELRos4
..C........C..A...........A.....T........C.......................G......-------..C...........A...........A.....T........C.......................G..C...-------..C........C..A...........A.....T........C.......................G......-------..C........C..A...........A.....T........C.......................G......-------..C........C..A...........A.....T........C.......................G......-------..C........C..A...........A.....T........C.......................G......-------..C........C..A...........A.....T........C.......................G......-------..C........C..A...........A.....T........C.......................G......-------..C........C..A...........A.....T........C.......................G......-------..C........C..A...........A.....T........C.......................G......-------..C........C..A...........A.....T........C.......................G......-------..C........C..A...........A.....T........C.......................G......-------..C........C..A...........A.....T........C.......................G......-------..C...........A...........A.....T........C.......................G......-------..C........C..A...........A.....T........C.......................G......-------..C........C..A...........A.....T........C.......................G......-------..C........C..A...........A.....T........C.......................G......-------..C........C..A...........A.....T........C.......................G......-------..C........C..A...........A.....T........C.......................G......-------..C...........A...........A.....T........C.......................G......-------..C........C..A...........A.....T........C.......................G......-------..C........C..A...........A.....T........C.......................G......-------..C...........A...........A.....T........C.......................G......-------..C........C..A...........A.....T........C.......................G......-------..C...........A...........A.....T........C.......................G......-------..C........C..A...........A.....T........C.......................G......-------..C...........A...........A.....T........C.......................G......-------..C........C..A...........A.....T........C.......................G......-------..C........C..A...........A.....T........C.......................G......-------..C........C..A...........A.....T........C.......................G......-------..C........C..A...........A.....T........C.......................G......-------..C........C..A...........A.....T........C.......................G......-------..C........C..A...........A.....T........C.......................G......-------..C........C..A...........A.....T........C.......................G......-------..C........C..A...........A.....T........C.......................G......-------..C........C..A...........A.....T........C.......................G......-------..C........C..A...........A.....T........C.......................G......-------..C........C..A...........A.....T........C.......................G......-------..C........C..A...........A.....T........C.......................G......-------..C........C..A...........A.....T........C.......................G......-------..C...........A...........A.....T........C.......................G..C...-------..C...........A...........A.....T...C....C.......................G..C...-------..C...........A...........A.....T........C.......................G..C...-------..C...........A...........A.....T........C.......................G..C...-------..C...........A...........A.....T........C.......................G..C...-------...........C...........A....................G...........................-------...........C...........A....................G...........................-------...........C...........A....................G...........................-------...........C...........A....................G...........................-------...........C...........A....................G...........................-------...........C...........A....................G...........................-------...........C...........A....................G...........................-------...........C...........A....................G.......................C...-------..C........C...........A.................C..G....................G..C...-------..C........C...........A.................C..G....................G..C...-------..C........C...........A.................C..G....................G..C...-------...........C...........A....................G...........................-------...........C...........A....................G...........................-------...........C...........A....................G...........................-------..C........C...........A.................C..G....................G..C...-------..C........C...........A.................C..G....................G..C...-------..C........C...........A.................C..G....................G..C...-------..C........C...........A.................C..G....................G..C...-------..C........C...........A.................C..G....................G..C...-------..C........C...........A.................C..G....................G..C...-------..C........C...........A.................C..G....................G..C...-------..C........C...........A.................C..G....................G..C...-------..C........C...........A.................C..G....................G..C...-------..C........C...........A.................C..G....................G..C...-------..C........C...........A.................C..G....................G..C...-------...........C...........A....................G...........................-------...........C...........A....................G...........................-------...........C...........A....................G...........................-------...........C...........A....................G...........................-------..C........C...........A.................C..G....................G..C...-------..C........C...........A..A......................................G..C...-------...........C...........A....................G...........................--------
91
bSTELRos5
bSTELRos6
bSTELRos7
bSTELRos8
bSTELRos9
bSTELRos10
bSTELRos11
bPEAsc1
bPEAsc2
bPEAsc3
bPEAsc4
bPEAsc5
bPEAsc6
bPEAsc7
bPEAsc8
bPEAsc9
bPEAsc11
bPEAsc12
bPEAsc13
TUT3
TUT6
TUT7
..C........C...........A.................C..G....................G..C...-------...........C...........A....................G...........................-------...........C...........A....................G...........................-------..C........C...........A.................C..G....................G..C...-------...........C...........A....................G...........................-------...........C...........A....................G...........................-------...........C...........A....................G...........................-------...........C...........A....................G...........................-------...........C...........A....................G...........................-------...........C...........A....................G...........................-------..C........C...........A.................C..G....................G..C...-------..C........C...........A.................C.......................G..C...-------..C........C...........A........T...........G.......................C...-------...........C...........A....................G...........................-------...........C...........A....................G...........................-------...........C...........A....................G...........................-------..C........C...........A.................C..G....................G..C...-------..C........C...........A.................C.......................G..C...-------...........C...........A....................G...........................-------........................................................................-------....................................A............G........C.A...........-------........................................................................--------
92
Appendix 2
Multiple alignment of the C. imicola nucleotide sequences of the COI partial gene fragment for all
61 individuals from different geographic areas. Culicoides tuttifrutti (TUT1) and C. bolitinos
(BOL22) sequences were used as reference species to generate the alignments. All the nucleotide
sites that are similar to TUT1 are represented by the dots. The alignment was used to compare the
C. imicola individuals of all the populations. The alignment was carried out using the Clustal X
program.
93
TUT1
BOL22
IMI11
IMI15
IMI16
iOPV1
iOPV2
iOPV3
iOPV4
iOPV5
iOPV6
iKP3
iOPV8
iOPV9
iOPV10
iOPV11
iKP4
iOPV13
iOPV14
iOPV15
iOPV16
iKP1
iKP2
iSTELBea1
iSTELTri1
iSTELRiv1
iSTELWod1
iSTELBea2
iSTELTr2
iSTELRiv2
iSTELWod2
iSTELKun1
iSTELBon1
iSTELBon2
iSTELBon3
iSTELBon4
iSTELBon5
iSTELKen1
iSTELKen2
iSTELKen3
iSTELRob1
iSTELRob2
iSTELRob3
iSTELRob4
iSTELRob5
iUITWic1
iUITWic2
iUITWic3
iUITWic4
iUITWic5
iUITWic6
iUITWic7
iUITWic8
iUITWic9
iUITWic10
iUITWic11
iUITWic12
iUITWic13
SCON7
SCON9
ADC19
PEV1
IBET1
10
20
30
40
50
60
70
80
....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|
TTTAATATTAGGAGCTCCTGATATAGCTTTTCCTCGAATAAATAATATAAGATTTTGAATATTACCCCCTTCAATTACTT
..............................C...................................T..G........A.
A...........G......................................T..............G..A..T......C
A...........G......................................T..............G..A..T......C
A...........G......................................T..............G..A..T......C
A...........G......................................T..............G..A..T......C
A...........G......................................T..............G..A..T......C
A...........G......................................T..............G..A..T......C
A...........G......................................T..............G..A..T......C
A...........G......................................T..............G..A..T......C
A...........G......................................T..............G..A..T......C
A...........G......................................T..............G..A..T......C
A...........G......................................T..............G..A..T......C
A...........G......................................T..............G..A..T......C
A...........G......................................T..............G..A..T......C
A...........G......................................T..............G..A..T......C
A...........G......................................T..............G..A..T......C
A...........G......................................T..............G..A..T......C
A...........G......................................T..............G..A..T......C
A...........G......................................T..............G..A..T......C
A...........G......................................T..............G..A..T......C
A...........G......................................T..............G..A..T......C
A...........G......................................T..............G..A..T......C
A...........G......................................T..............G..A..T......C
A...........G......................................T..............G..A..T......C
A...........G......................................T..............G..A..T......C
A...........G......................................T..............G..A..T......C
A...........G......................................T..............G..A..T......C
A...........G......................................T..............G..A..T......C
A...........G......................................T..............G..A..T......C
A...........G......................................T..............G..A..T......C
A...........G......................................T..............G..A..T......C
A...........G......................................T..............G..A..T......C
A...........G......................................T..............G..A..T......C
A...........G......................................T..............G..A..T......C
A...........G......................................T..............G..A..T......C
A...........G......................................T..............G..A..T......C
A...........G......................................T..............G..A..T......C
A...........G......................................T..............G..A..T......C
A...........G......................................T..............G..A..T......C
A...........G......................................T..............G..A..T......C
A...........G......................................T..............G..A..T......C
A...........G...........G..........................T..............G..A..T......C
A...........G...........G..........................T..............G..A..T......C
A...........G...........G..........................T..............G..A..T......C
C...........G......................................T..............G..A..T......C
C...........G......................................T..............G..A..T......C
C...........G......................................T..............G..A..T......C
C...........G......................................T..............G..A..T......C
C...........G......................................T..............G..A..T......C
C...........G......................................T..............G..A..T......C
C...........G......................................T..............G..A..T......C
C...........G......................................T..............G..A..T......C
C...........G......................................T..............G..A..T......C
C...........G......................................T..............G..A..T......C
C...........G......................................T..............G..A..T......C
C...........G......................................T..............G..A..T......C
C...........G......................................T..............G..A..T......C
............G......................................T.................A..T.......
............G......................................T.................A..T......C
............G......................................T..............G..A..T......C
............G......................................T.................A..T.......
............G......................................T.................A..T......C
TUT1
BOL22
IMI11
IMI15
IMI16
iOPV1
iOPV2
iOPV3
iOPV4
90
100
110
120
130
140
150
160
....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|
TACTTTTATTAAGTAGATTAGTAGAAAATGGAGCAGGGACAGGATGAACAGTTTACCCTCCTTTATCTGCAAATATTTCT
.............A..............C..G.....A........G.....................T.T...G.....
.T...................................A...........T.....T.....A.....A......G.....
.T...................................A...........T.....T.....A.....A......G.....
.T...................................A...........T.....T.....A.....A......G.....
.T...................................A...........T.....T.....A.....A......G.C...
.T...................................A...........T.....T.....A.....A......G.C...
.T...................................A...........T.....T.....A.....A......G.C...
.T...................................A...........T.....T.....A.....A......G.C...
94
iOPV5
iOPV6
iKP3
iOPV8
iOPV9
iOPV10
iOPV11
iKP4
iOPV13
iOPV14
iOPV15
iOPV16
iKP1
iKP2
iSTELBea1
iSTELTri1
iSTELRiv1
iSTELWod1
iSTELBea2
iSTELTr2
iSTELRiv2
iSTELWod2
iSTELKun1
iSTELBon1
iSTELBon2
iSTELBon3
iSTELBon4
iSTELBon5
iSTELKen1
iSTELKen2
iSTELKen3
iSTELRob1
iSTELRob2
iSTELRob3
iSTELRob4
iSTELRob5
iUITWic1
iUITWic2
iUITWic3
iUITWic4
iUITWic5
iUITWic6
iUITWic7
iUITWic8
iUITWic9
iUITWic10
iUITWic11
iUITWic12
iUITWic13
SCON7
SCON9
ADC19
PEV1
IBET1
.T...................................A...........T.....T.....A.....A......G.....
.T...................................A...........T.....T.....A.....A......G.C...
.T...................................A...........T.....T.....A.....A......G.....
.T...................................A...........T.....T.....A.....A......G.....
.T...................................A...........T.....T.....A.....A......G.C...
.T...................................A...........T.....T.....A.....A......G.....
.T...................................A...........T.....T.....A.....A......G.....
.T...................................A...........T.....T.....A.....A......G.....
.T...................................A...........T.....T.....A.....A......G.C...
.T...................................A...........T.....T.....A.....A......G.....
.T...................................A...........T.....T.....A.....A......G.C...
.T...................................A...........T.....T.....A.....A......G.....
.T...................................A...........T.....T.....A.....A......G.....
.T...................................A...........T.....T.....A.....A......G.....
.T...................................A...........T.....T.....A.....A......G.C...
.T...................................A...........T.....T.....A.....A......G.C...
.T...................................A...........T.....T.....A.....A......G.....
.T...................................A...........T.....T.....A.....A......G.C...
.T...................................A...........T.....T.....A.....A......G.C...
.T...................................A...........T.....T.....A.....A......G.C...
.T...................................A...........T.....T.....A.....A......G.C...
.T...................................A...........T.....T.....A.....A......G.C...
.T...................................A...........T.....T.....A.....A......G.C...
.T...................................A...........T.....T.....A.....A......G.C...
.T...................................A...........T.....T.....A.....A......G.C...
.T...................................A...........T.....T.....A.....A......G.C...
.T...................................A...........T.....T.....A.....A......G.....
.T...................................A...........T.....T.....A.....A......G.C...
.T...................................A...........T.....T.....A.....A......G.C...
.T...................................A...........T.....T.....A.....A......G.....
.T...................................A...........T.....T.....A.....A......G.C...
.T...................................A...........T.....T.....A.....A......G.C...
.T...................................A...........T.....T.....A.....A......G.....
.T...................................A...........T.....T.....A.....A......G.C...
.T...................................A...........T.....T.....A.....A......G.....
.T...................................A...........T.....T.....A.....A......G.C...
.T...................................A...........T.....T.....A.....A......G.....
.T...................................A...........T.....T.....A.....A......G.....
.T...................................A...........T.....T.....A.....A......G.....
.T...................................A...........T.....T.....A.....A......G.....
.T...................................A...........T.....T.....A.....A......G.....
.T...................................A...........T.....T.....A.....A......G.....
.T...................................A...........T.....T.....A.....A......G.....
.T...................................A...........T.....T.....A.....A......G.....
.T...................................A...........T.....T.....A.....A......G.....
.T...................................A...........T.....T.....A.....A......G.....
.T...................................A...........T.....T.....A.....A......G.....
.T...................................A...........T.....T.....A.....A......G.....
.T...................................A...........T.....T.....A.....A......G.....
.T...................................A...........T.....T.....A.....A......G.C...
.T...................................A...........T.....T.....A.....A......G.C...
.T...................................A...........T.....T.....A.....A......G.C...
.T...................................A...........T.....T.....A.....A......G.C...
.T...................................A...........T.....T.....A.....A......G.C...
TUT1
BOL22
IMI11
IMI15
IMI16
iOPV1
iOPV2
iOPV3
iOPV4
iOPV5
iOPV6
iKP3
iOPV8
iOPV9
iOPV10
iOPV11
iKP4
iOPV13
iOPV14
iOPV15
170
180
190
200
210
220
230
240
....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|
CATGCTGGTGCTTCTGTTGATTTAGCAATTTTTTCTTTACATTTAGCAGGAATTAGATCTATTTTAGGAGCTGTAAATTT
........A.................T....................C..G........A........G...........
........A.....A...........T.....C..............T..G.....T..A........T...........
........A.....A...........T.....C..............T..G.....T..A........T...........
........A.....A...........T.....C..............T..G.....T..A........T...........
........A.....A...........T.....C..............T..G.....T..A........T...........
........A.....A...........T.....C..............T..G.....T..A........T...........
........A.....A...........T.....C..............T..G.....T..A........T...........
........A.....A...........T.....C..............T..G.....T..A........T...........
........A.....A...........T.....C..............T..G.....T..A........T...........
........A.....A...........T.....C..............T..G.....T..A........T...........
........A.....A...........T.....C..............T..G.....T..A........T...........
........A.....A...........T.....C..............T..G.....T..A........T...........
........A.....A...........T.....C..............T..G.....T..A........T...........
........A.....A...........T.....C..............T..G.....T..A........T...........
........A.....A...........T.....C..............T..G.....T..A........T...........
........A.....A...........T.....C..............T..G.....T..A........T...........
........A.....A...........T.....C..............T..G.....T..A........T...........
........A.....A...........T.....C..............T..G.....T..A........T...........
........A.....A...........T.....C..............T..G.....T..A........T...........
95
iOPV16
iKP1
iKP2
iSTELBea1
iSTELTri1
iSTELRiv1
iSTELWod1
iSTELBea2
iSTELTr2
iSTELRiv2
iSTELWod2
iSTELKun1
iSTELBon1
iSTELBon2
iSTELBon3
iSTELBon4
iSTELBon5
iSTELKen1
iSTELKen2
iSTELKen3
iSTELRob1
iSTELRob2
iSTELRob3
iSTELRob4
iSTELRob5
iUITWic1
iUITWic2
iUITWic3
iUITWic4
iUITWic5
iUITWic6
iUITWic7
iUITWic8
iUITWic9
iUITWic10
iUITWic11
iUITWic12
iUITWic13
SCON7
SCON9
ADC19
PEV1
IBET1
........A.....A...........T.....C..............T..G.....T..A........T...........
........A.....A...........T.....C..............T..G.....T..A........T...........
........A.....A...........T.....C..............T..G.....T..A........T...........
........A.....A...........T.....C..............T..G.....T..A........T...........
........A.....A...........T.....C..............T..G.....T..A........T...........
........A.....A...........T.....C..............T..G.....T..A........T...........
........A.....A...........T.....C..............T..G.....T..A........T...........
........A.....A...........T.....C..............T..G.....T..A........T...........
........A.....A...........T.....C..............T..G.....T..A........T...........
........A.....A...........T.....C..............T..G.....T..A........T...........
........A.....A...........T.....C..............T..G.....T..A........T...........
........A.....A...........T.....C..............T..G.....T..A........T...........
........A.....A...........T.....C..............T..G.....T..A........T...........
........A.....A...........T.....C..............T..G.....T..A........T...........
........A.....A...........T.....C..............T..G.....T..A........T...........
........A.....A...........T.....C..............T..G.....T..A........T...........
........A.....A...........T.....C..............T..G.....T..A........T...........
........A.....A...........T.....C..............T..G.....T..A........T...........
........A.....A...........T.....C..............T..G.....T..A........T...........
........A.....A...........T.....C..............T..G.....T..A........T...........
........A.....A...........T.....C..............T..G.....T..A........T...........
........A.....A...........T.....C..............T..G.....T..A........T...........
........A.....A...........T.....C..............T..G.....T..A........T...........
........A.....A...........T.....C..............T..G.....T..A........T...........
........A.....A...........T.....C..............T..G.....T..A........T...........
........A.....A...........T.....C..............T..G.....T..A........T...........
...T....A.....A...........T.....C..............T..G.....T..A........T...........
...T....A.....A...........T.....C..............T..G.....T..A........T...........
........A.....A...........T.....C..............T..G.....T..A........T...........
........A.....A...........T.....C..............T..G.....T..A........T...........
........A.....A...........T.....C..............T..G.....T..A........T...........
........A.....A...........T.....C..............T..G.....T..A........T...........
........A.....A...........T.....C..............T..G.....T..A........T...........
...T....A.....A...........T.....C..............T..G.....T..A........T...........
........A.....A...........T.....C..............T..G.....T..A........T...........
........A.....A...........T.....C..............T..G.....T..A........T...........
........A.....A...........T.....C..............T..G.....T..A........T...........
........A.....A...........T.....C..............T..G.....T..A........T...........
........A.....A...........T.....C..............T..G.....T..A........T...........
........A.....A...........T.....C..............T..G.....T..A........T...........
........A.....A...........T.....C..............T..G.....T..A........T...........
........A.....A...........T.....C..............T..G.....T..A........T...........
........A.....A...........T.....C..............T..G.....T..A........T...........
TUT1
BOL22
IMI11
IMI15
IMI16
iOPV1
iOPV2
iOPV3
iOPV4
iOPV5
iOPV6
iKP3
iOPV8
iOPV9
iOPV10
iOPV11
iKP4
iOPV13
iOPV14
iOPV15
iOPV16
iKP1
iKP2
iSTELBea1
iSTELTri1
iSTELRiv1
iSTELWod1
iSTELBea2
iSTELTr2
iSTELRiv2
iSTELWod2
250
260
270
280
290
300
310
320
....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|
TATTACTACTATTATTAATATACGACCAATAGGAATATCTTTAGATCGAATGCCTTTATTTGTTTGATCAGTATTAATTA
............................G........A.............A....................G...C.A.
......A..A..............T..TGA.......A..A.G........A.......................T....
......A..A..............T..TGA.......A..A.G........A.......................T....
......A..A..............T..TGA.......A..A.G........A.......................T....
......A..A..............T..TGA.......A..A.G........A.......................T....
......A..A..............T..TGA.......A..A.G........A.......................T....
......A..A..............T..TGA.......A..A.G........A.......................T....
......A..A..............T..TGA.......A..A.G........A.......................T....
......A..A..............T..TGA.......A..A.G........A.......................T....
......A..A..............T..TGA.......A..A.G........A.......................T....
......A..A..............T..TGA.......A..A.G........A.......................T....
......A..A..............T..TGA.......A..A.G........A.......................T....
......A..A..............T..TGA.......A..A.G........A.......................T....
......A..A..............T..TGA.......A..A.G........A.......................T....
......A..A..............T..TGA.......A..A.G........A.......................T....
......A..A..............T..TGA.......A..A.G........A.......................T....
......A..A..............T..TGA.......A..A.G........A.......................T....
......A..A..............T..TGA.......A..A.G........A.......................T....
......A..A..............T..TGA.......A..A.G........A.......................T....
......A..A..............T..TGA.......A..A.G........A.......................T....
......A..A..............T..TGA.......A..A.G........A.......................T....
......A..A..............T..TGA.......A..A.G........A.......................T....
......A..A..............T..TGA.......A..A.G........A.......................T....
......A..A..............T..TGA.......A..A.G........A.......................T....
......A..A..............T..TGA.......A..A.G........A.......................T....
......A..A..............T..TGA.......A..A.G........A.......................T....
......A..A..............T..TGA.......A..A.G........A.......................T....
......A..A..............T..TGA.......A..A.G........A.......................T....
......A..A..............T..TGA.......A..A.G........A.......................T....
......A..A..............T..TGA.......A..A.G........A.......................T....
96
iSTELKun1
iSTELBon1
iSTELBon2
iSTELBon3
iSTELBon4
iSTELBon5
iSTELKen1
iSTELKen2
iSTELKen3
iSTELRob1
iSTELRob2
iSTELRob3
iSTELRob4
iSTELRob5
iUITWic1
iUITWic2
iUITWic3
iUITWic4
iUITWic5
iUITWic6
iUITWic7
iUITWic8
iUITWic9
iUITWic10
iUITWic11
iUITWic12
iUITWic13
SCON7
SCON9
ADC19
PEV1
IBET1
......A..A..............T..TGA.......A..A.G........A.......................T....
......A..A..............T..TGA.......A..A.G........A.......................T....
......A..A..............T..TGA.......A..A.G........A.......................T....
......A..A..............T..TGA.......A..A.G........A.......................T....
......A..A..............T..TGA.......A..A.G........A.......................T....
......A..A..............T..TGA.......A..A.G........A.......................T....
......A..A..............T..TGA.......A..A.G........A.......................T....
......A..A..............T..TGA.......A..A.G........A.......................T....
......A..A..............T..TGA.......A..A.G........A.......................T....
......A..A..............T..TGA.......A..A.G........A.......................T....
......A..A..............T..TGA.......A..A.G........A.......................T....
......A..A..............T..TGA.......A..A.G........A.......................T....
......A..A..............T..TGA.......A..A.G........A.......................T....
......A..A..............T..TGA.......A..A.G........A.......................T....
......A..A..............T..TGA.......A..A.G........A.......................T....
......A..A..............T..TGA.......A..A.G........A.......................T....
......A..A..............T..TGA.......A..A.G........A.......................T....
......A..A..............T..TGA.......A..A.G........A.......................T....
......A..A..............T..TGA.......A..A.G........A.......................T....
......A..A..............T..TGA.......A..A.G........A.......................T....
......A..A..............T..TGA.......A..A.G........A.......................T....
......A..A..............T..TGA.......A..A.G........A.......................T....
......A..A..............T..TGA.......A..A.G........A.......................T....
......A..A..............T..TGA.......A..A.G........A.......................T....
......A..A..............T..TGA.......A..A.G........A.......................T....
......A..A..............T..TGA.......A..A.G........A.......................T....
......A..A..............T..TGA.......A..A.G........A.......................T....
......A..A..............T..TGA.......A..A.G........A.......................T....
......A..A..............T..TGA.......A..A.G........A.......................T....
......A..A..............T..TGA.......A..A.G........A.......................T....
......A..A..............T..TGA.......A..A.G........A.......................T....
......A..A..............T..TGA.......A..A.G........A.......................T....
TUT1
BOL22
IMI11
IMI15
IMI16
iOPV1
iOPV2
iOPV3
iOPV4
iOPV5
iOPV6
iKP3
iOPV8
iOPV9
iOPV10
iOPV11
iKP4
iOPV13
iOPV14
iOPV15
iOPV16
iKP1
iKP2
iSTELBea1
iSTELTri1
iSTELRiv1
iSTELWod1
iSTELBea2
iSTELTr2
iSTELRiv2
iSTELWod2
iSTELKun1
iSTELBon1
iSTELBon2
iSTELBon3
iSTELBon4
iSTELBon5
iSTELKen1
iSTELKen2
iSTELKen3
iSTELRob1
iSTELRob2
330
340
350
360
370
380
390
400
....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|
CAGCAATTTTATTATTGTTATCATTACCTGTTTTAGCTGGTGCTATTACAATATTATTAACTGATCGAAATATTAATACT
....T........G..A...........A........A..A........T........G...........C.........
....T.........C.T.....T........G.....A..G........T...........A.....G............
....T.........C.T.....T........G.....A..G........T...........A.....G............
....T.........C.T.....T........G.....A..G........T...........A.....G............
....T.........C.T.....T........G.....A..G....................A.....G............
....T.........C.T.....T........G.....A..G....................A.....G............
....T.........C.T.....T........G.....A..G....................A.....G............
....T.........C.T.....T........G.....A..G....................A.....G............
....T.........C.T.....T........G.....A..G....................A.....G............
....T.........C.T.....T........G.....A..G....................A.....G............
....T.........C.T.....T........G.....A..G....................A.....G............
....T.........C.T.....T........G.....A..G....................A.....G............
....T.........C.T.....T........G.....A..G....................A.....G............
....T.........C.T.....T........G.....A..G....................A.....G............
....T.........C.T.....T........G.....A..G....................A.....G............
....T.........C.T.....T........G.....A..G....................A.....G............
....T.........C.T.....T........G.....A..G....................A.....G............
....T.........C.T.....T........G.....A..G....................A.....G............
....T.........C.T.....T........G.....A..G....................A.....G............
....T.........C.T.....T........G.....A..G....................A.....G............
....T.........C.T.....T........G.....A..G....................A.....G............
....T.........C.T.....T........G.....A..G....................A.....G............
....T.........C.T.....T........G.....A..G....................A.....G............
....T.........C.T.....T........G.....A..G....................A.....G............
....T.........C.T.....T........G.....A..G....................A.....G............
....T.........C.T.....T........G.....A..G....................A.....G............
....T.........C.T.....T........G.....A..G....................A.....G............
....T.........C.T.....T........G.....A..G....................A.....G............
....T.........C.T.....T........G.....A..G....................A.....G............
....T.........C.T.....T........G.....A..G....................A.....G............
....T.........C.T.....T........G.....A..G....................A.....G............
....T.........C.T.....T........G.....A..G....................A.....G............
....T.........C.T.....T........G.....A..G....................A.....G............
....T.........C.T.....T........G.....A..G....................A.....G............
....T.........C.T.....T........G.....A..G....................A.....G............
....T.........C.T.....T........G.....A..G....................A.....G............
....T.........C.T.....T........G.....A..G....................A.....G............
....T.........C.T.....T........G.....A..G....................A.....G............
....T.........C.T.....T........G.....A..G....................A.....G............
....T.........C.T.....T........G.....A..G....................A.....G............
....T.........C.T.....T........G.....A..G....................A.....G............
97
iSTELRob3
iSTELRob4
iSTELRob5
iUITWic1
iUITWic2
iUITWic3
iUITWic4
iUITWic5
iUITWic6
iUITWic7
iUITWic8
iUITWic9
iUITWic10
iUITWic11
iUITWic12
iUITWic13
SCON7
SCON9
ADC19
PEV1
IBET1
....T.........C.T.....T........G.....A..G....................A.....G............
....T.........C.T.....T........G.....A..G....................A.....G............
....T.........C.T.....T........G.....A..G....................A.....G............
....T.........C.T.....T........G.....A..G....................A.....G............
....T.........C.T.....T........G.....A..G....................A.....G............
....T.........C.T.....T........G.....A..G....................A.....G............
....T.........C.T.....T........G.....A..G....................A.....G............
....T.........C.T.....T........G.....A..G....................A.....G............
....T.........C.T.....T........G.....A..G....................A.....G............
....T.........C.T.....T........G.....A..G....................A.....G............
....T.........C.T.....T........G.....A..G....................A.....G............
....T.........C.T.....T........G.....A..G....................A.....G............
....T.........C.T.....T........G.....A..G....................A.....G............
....T.........C.T.....T........G.....A..G....................A.....G............
....T.........C.T.....T........G.....A..G....................A.....G............
....T.........C.T.....T........G.....A..G....................A.....G............
....T.........C.T.....T........G.....A..G....................A.....G............
....T.........C.AC....TC.......G.....A..G....................A.....G............
....T.........C.T.....T........G.....A..G....................A.....G............
....T.........C.C.....TC.......G.....A..G....................A.....G............
....T.........C.T.....T........G.....A..G....................A.....G............
TUT1
BOL22
IMI11
IMI15
IMI16
iOPV1
iOPV2
iOPV3
iOPV4
iOPV5
iOPV6
iKP3
iOPV8
iOPV9
iOPV10
iOPV11
iKP4
iOPV13
iOPV14
iOPV15
iOPV16
iKP1
iKP2
iSTELBea1
iSTELTri1
iSTELRiv1
iSTELWod1
iSTELBea2
iSTELTr2
iSTELRiv2
iSTELWod2
iSTELKun1
iSTELBon1
iSTELBon2
iSTELBon3
iSTELBon4
iSTELBon5
iSTELKen1
iSTELKen2
iSTELKen3
iSTELRob1
iSTELRob2
iSTELRob3
iSTELRob4
iSTELRob5
iUITWic1
iUITWic2
iUITWic3
iUITWic4
iUITWic5
iUITWic6
iUITWic7
iUITWic8
410
420
430
440
450
460
470
....|....|....|....|....|....|....|....|....|....|....|....|....|....|..
TCATTTTTTGATCCTGCAGGAGGGGGGGATCCAATTTTATATCAACATTTATTTTGATTTTTTGGTCATCCA
...........C...........A....................G...........................
..C........C..A........A..A.....T........C.......................G......
..C........C..A........A..A.....T........C.......................G......
..C........C..A........A..A.....T........C.......................G......
..C...........A...........A.....T........C.......................G..C...
..C...........A...........A.....T........C.......................G..C...
..C...........A...........A.....T........C.......................G..C...
..C...........A...........A.....T........C.......................G..C...
..C........C..A...........A.....T........C.......................G......
..C...........A...........A.....T........C.......................G......
..C........C..A...........A.....T........C.......................G......
..C........C..A...........A.....T........C.......................G......
..C...........A...........A.....T........C.......................G..C...
..C........C..A...........A.....T........C.......................G......
..C........C..A...........A.....T........C.......................G......
..C........C..A...........A.....T........C.......................G......
..C...........A...........A.....T........C.......................G..C...
..C........C..A...........A.....T........C.......................G......
..C...........A...........A.....T........C.......................G..C...
..C........C..A...........A.....T........C.......................G......
..C........C..A...........A.....T........C.......................G......
..C........C..A...........A.....T........C.......................G......
..C........C..A...........A.....T........C.......................G......
..C........C..A...........A.....T........C.......................G......
..C........C..A...........A.....T........C.......................G......
..C........C..A...........A.....T........C.......................G......
..C........C..A...........A.....T........C.......................G......
..C........C..A...........A.....T........C.......................G......
..C........C..A...........A.....T........C.......................G......
..C........C..A...........A.....T........C.......................G......
..C...........A...........A.....T........C.......................G......
..C........C..A...........A.....T........C.......................G......
..C........C..A...........A.....T........C.......................G......
..C........C..A...........A.....T........C.......................G......
..C........C..A...........A.....T........C.......................G......
..C........C..A...........A.....T........C.......................G......
..C...........A...........A.....T........C.......................G......
..C........C..A...........A.....T........C.......................G......
..C........C..A...........A.....T........C.......................G......
..C...........A...........A.....T........C.......................G......
..C........C..A...........A.....T........C.......................G......
..C...........A...........A.....T........C.......................G......
..C........C..A...........A.....T........C.......................G......
..C...........A...........A.....T........C.......................G......
..C........C..A...........A.....T........C.......................G......
..C........C..A...........A.....T........C.......................G......
..C........C..A...........A.....T........C.......................G......
..C........C..A...........A.....T........C.......................G......
..C........C..A...........A.....T........C.......................G......
..C........C..A...........A.....T........C.......................G......
..C........C..A...........A.....T........C.......................G......
..C........C..A...........A.....T........C.......................G......
98
iUITWic9
iUITWic10
iUITWic11
iUITWic12
iUITWic13
SCON7
SCON9
ADC19
PEV1
IBET1
..C........C..A...........A.....T........C.......................G......
..C........C..A...........A.....T........C.......................G......
..C........C..A...........A.....T........C.......................G......
..C........C..A...........A.....T........C.......................G......
..C........C..A...........A.....T........C.......................G......
..C...........A...........A.....T........C.......................G..C...
..C...........A...........A.....T...C....C.......................G..C...
..C...........A...........A.....T........C.......................G..C...
..C...........A...........A.....T........C.......................G..C...
..C...........A...........A.....T........C.......................G..C...
99
Appendix 3
Multiple alignment of the C. bolitinos nucleotide sequences of the COI partial gene fragment for all
51 individuals from different geographic areas. Culicoides imicola (iOPV1) sequence was used as
a reference species to generate the alignment. Only the nucleotide sites that differ from the iOPV1
are shown. The dots represent identical nucleotide sites and the symbol (-) represent deletions.
The alignment was used to compare the C. bolitinos individuals of all sampled populations. The
alignment was generated using the Clustal X program.
100
iOPV1
BOL14
BOL17
BOL20
BOL22
bCLA1
bCLA2
bCLA3
bCLA4
bCLA6
bCLA7
bCLA8
bCLA9
bCLA10
bGEOOute1
bGEOKid1
bGEOKid2
bGEOKid3
bGEOKid4
bGEORid1
bGEORid2
bGEORid3
bGEORid4
bGEORid5
bGEORid6
bGEORid7
bGEORid8
bSTELRob1
bSTELRob2
bSTELRob3
bSTELFar1
bSTELFar3
bSTELRos4
bSTELRos5
bSTELRos6
bSTELRos7
bSTELRos8
bSTELRos9
bSTELRos10
bSTELRos11
bPEAsc1
bPEAsc2
bPEAsc3
bPEAsc4
bPEAsc5
bPEAsc6
bPEAsc7
bPEAsc8
bPEAsc9
bPEAsc11
bPEAsc12
bPEAsc13
10
20
30
40
50
60
70
80
....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|
ATTAATATTAGGGGCTCCTGATATAGCTTTTCCTCGAATAAATAATATAAGTTTTTGAATATTACCGCCATCTATTACTC
T...........A.................C....................A..............T..G..A.....AT
T...........A.................C....................A..............T..G..A.....AT
T...........A.................C....................A..............T..G..A.....AT
T...........A.................C....................A..............T..G..A.....AT
T...........A.................C....................A..............T..G..A.....AT
T...........A.................C....................A..............T..G..A.....AT
T...........A.................C....................A..............T..G..A.....AT
T...........A.................C....................A..............T..G..A.....AT
T..................................................A..............T.....A......T
T..................................................A..............T.....A......T
T..................................................A..............T.....A......T
T...........A.................C....................A..............T..G..A.....AT
T...........A.................C....................A..............T..G..A.....AT
T...T.......A...........G.....C....................A..............T..G..A.....AT
..................................G................A....................A......T
T..................................................A..............T.....A......T
T..................................................A..............T.....A......T
..................................G................A....................A......T
..................................G................A....................A......T
T..................................................A..............T.....A......T
..................................G................A....................A......T
..................................G................A....................A......T
T..................................................A..............T.....A......T
..................................G................A....................A......T
T..................................................A..............T.....A......T
T...T.......A...........G.....C....................A..............T..G..A.....AT
T...........A.................C....................A..............T..G..A.....AT
T...........A.................C....................A..............T..G..A.....AT
T...........A.................C....................A..............T..G..A.....AT
T..................................................A..............T.....A......T
T..................................................A..............T.....A......T
T...........A.................C....................A..............T..G..A.....AT
T..................................................A..............T.....A......T
T...........A.................C....................A..............T..G..A.....AT
T...........A.................C....................A..............T..G..A.....AT
T..................................................A..............T.....A......T
T...........A.................C....................A..............T..G..A.....AT
T...........A.................C....................A..............T..G..A.....AT
T...........A.................C....................A..............T..G..A.....AT
T...........A.................C....................A..............T..G..A.....AT
T...........A.................C....................A..............T..G..A.....AT
T...........A.................C....................A..............T..G..A.....AT
T..................................................A..............T.....A......T
T..................................................A..............T.....A......T
T...........A.................C....................A..............T..G..A.....AT
T...........A.................C....................A..............T..G..A.....AT
T...........A.................C....................A..............T..G..A.....AT
T...........A.................C....................A..............T..G..A.....AT
T..................................................A..............T.....A......T
T..................................................A..............T.....A......T
T...........A.................C....................A..............T..G..A.....AT
iOPV1
BOL14
BOL17
BOL20
BOL22
bCLA1
bCLA2
bCLA3
bCLA4
bCLA6
bCLA7
bCLA8
bCLA9
bCLA10
bGEOOute1
bGEOKid1
bGEOKid2
bGEOKid3
bGEOKid4
bGEORid1
90
100
110
120
130
140
150
160
....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|
TTCTTTTATTAAGTAGATTAGTAGAAAATGGAGCAGGAACAGGATGAACTGTTTATCCTCCATTATCAGCAAATGTCTCT
.A...........A..............C..G..............G..A.....C.....T.....TT.T.....T...
.A...........A..............C..G..............G..A.....C.....T.....TT.T.....T...
.A...........A..............C..G..............G..A.....C.....T.....TT.T.....T...
.A...........A..............C..G..............G..A.....C.....T.....TT.T.....T...
.A...........A..............C..G..............G..A.....C.....T.....TT.T.....T...
.A...........A..............C..G..............G..A.....C.....T.....TT.T.....T...
.A...........A..............C..G..............G..A.....C.....T.....TT.T.....T...
.A...........A..............C..G..............G..A.....C.....T.....TT.T.....T...
.A...........A..............C..G..............G..A.....C.....T.....TT.......T...
.A...........A..............C..G..............G..A.....C.....T.....TT.......T...
.A...........A..............C..G..............G..A.....C.....T.....TT.......T...
.A...........A..............C..G..............G..A.....C.....T.....TT.T.....T...
.A...........A..............C..G..............G..A.....C.....T.....TT.T.....T...
.A...........A..............C..G..............G..A.....C.....T.....TT.T.....T...
.............A..............C..G..............G..A...........T......T.......T...
..T..........A..............C..G..............G..A.....C.....T.....TT.......T...
.C...........A..............C..G..............G..A.....C.....T.....TT.......T...
.............A..............C..G..............G..A...........T......T.......T...
.............A..............C..G..............G..A...........T......T.......T...
101
bGEORid2
bGEORid3
bGEORid4
bGEORid5
bGEORid6
bGEORid7
bGEORid8
bSTELRob1
bSTELRob2
bSTELRob3
bSTELFar1
bSTELFar3
bSTELRos4
bSTELRos5
bSTELRos6
bSTELRos7
bSTELRos8
bSTELRos9
bSTELRos10
bSTELRos11
bPEAsc1
bPEAsc2
bPEAsc3
bPEAsc4
bPEAsc5
bPEAsc6
bPEAsc7
bPEAsc8
bPEAsc9
bPEAsc11
bPEAsc12
bPEAsc13
..T..........A..............C..G..............G..A.....C.....T.....TT.......T...
.............A..............C..G..............G..A...........T......T.......T...
.............A..............C..G..............G..A...........T......T.......T...
..T..........A..............C..G..............G..A.....C.....T.....TT.......T...
.............A..............C..G..............G..A...........T......T.......T...
.C...........A..............C..G..............G..A.....C.....T.....TT.......T...
.A...........A..............C..G..............G..A.....C.....T.....TT.T.....T...
.A...........A..............C..G..............G..A.....C.....T.....TT.T.....T...
.A...........A..............C..G..............G..A.....C.....T.....TT.T.....T...
.A...........A..............C..G..............G..A.....C.....T.....TT.T.....T...
.............A..............C..G..............G..A.....C.....T.....TT.......T...
.............A..............C..G..............G..A.....C.....T.....TT.......T...
.A...........A..............C..G..............G..A.....C.....T.....TT.T.....T...
.............A..............C..G..............G..A.....C.....T.....TT.......T...
.A...........A..............C..G..............G..A.....C.....T.....TT.T.....T...
.A...........A..............C..G..............G..A.....C.....T.....TT.T.....T...
.............A..............C..G..............G..A.....C.....T.....TT.......T...
.A...........A..............C..G..............G..A.....C.....T.....TT.T.....T...
.A...........A..............C..G..............G..A.....C.....T.....TT.T.....T...
.A...........A..............C..G..............G..A.....C.....T.....TT.T.....T...
.A...........A..............C..G..............G..A.....C.....T.....TT.T.....T...
.A...........A..............C..G..............G..A.....C.....T.....TT.T.....T...
.A...........A..............C..G..............G..A.....C.....T.....TT.T.....T...
.............A..............C..G..............G..A.....C.....T......A.......T...
.............A..............C..G..............G..A.....C.....T.....TT.......T...
.A...........A..............C..G..............G..A.....C.....T.....TT.T.....T...
.A...........A..............C..G..............G..A.....C.....T.....TT.T.....T...
.A...........A..............C..G..............G..A.....C.....T.....TT.T.....T...
.A...........A..............C..G..............G..A.....C.....T.....TT.T.....T...
.............A..............C..G..............G..A.....C.....T......A.......T...
.............A..............C..G..............G..A.....C.....T.....TT.......T...
.A...........A..............C..G..............G..A.....C.....T.....TT.T.....T...
iOPV1
BOL14
BOL17
BOL20
BOL22
bCLA1
bCLA2
bCLA3
bCLA4
bCLA6
bCLA7
bCLA8
bCLA9
bCLA10
bGEOOute1
bGEOKid1
bGEOKid2
bGEOKid3
bGEOKid4
bGEORid1
bGEORid2
bGEORid3
bGEORid4
bGEORid5
bGEORid6
bGEORid7
bGEORid8
bSTELRob1
bSTELRob2
bSTELRob3
bSTELFar1
bSTELFar3
bSTELRos4
bSTELRos5
bSTELRos6
bSTELRos7
bSTELRos8
bSTELRos9
bSTELRos10
bSTELRos11
bPEAsc1
bPEAsc2
170
180
190
200
210
220
230
240
....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|
CATGCTGGAGCTTCAGTTGATTTAGCTATTTTCTCTTTACATTTAGCTGGGATTAGTTCAATTTTAGGTGCTGTAAATTT
..............T.................T..............C........A...........G...........
..............T.................T..............C........A...........G...........
..............T.................T..............C........A...........G...........
..............T.................T..............C........A...........G...........
..............T.................T..............C........A...........G...........
..............T.................T..............C........A...........G...........
..............T.................T..............C........A...........G...........
..............T.................T..............C........A...........G...........
..............T.................T..............C........A...........G...........
..............T.................T..............C........A...........G...........
..............T.................T..............C........A...........G...........
..............T.................T..............C........A...........G...........
..............T.................T..............C........A...........G...........
..............T.................T..............C........A...........G...........
...............................................C........A...........G...........
...............................................C........A...........G...........
...............................................C........A...........G...........
...............................................C........A...........G...........
...............................................C........A...........G...........
...............................................C........A...........G...........
...............................................C........A...........G...........
...............................................C........A...........G...........
...............................................C........A...........G...........
...............................................C........A...........G...........
...............................................C........A...........G...........
..............T.................T..............C........A...........G...........
..............T.................T..............C........A...........G...........
..............T.................T..............C........A...........G...........
..............T.................T..............C........A...........G...........
................................T..............C........A...........G...........
................................T..............C........A...........G...........
..............T.................T..............C........A...........G...........
................................T..............C........A...........G...........
..............T.................T..............C........A...........G...........
..............T.................T..............C........A...........G...........
................................T..............C........A...........G...........
..............T.................T..............C........A...........G...........
..............T.................T..............C........A...........G...........
..............T.................T..............C........A...........G...........
..............T.................T..............C........A...........G...........
..............T.................T..............C........A...........G...........
102
bPEAsc3
bPEAsc4
bPEAsc5
bPEAsc6
bPEAsc7
bPEAsc8
bPEAsc9
bPEAsc11
bPEAsc12
bPEAsc13
..............T.................T..............C........A...........G...........
...............................................C........A...........G...........
................................T..............C........A...........G...........
..............T.................T..............C........A...........G...........
..............T.................T..............C........A...........G...........
..............T.................T..............C........A...........G...........
..............T.................T..............C........A...........G...........
...............................................C........A...........G...........
................................T..............C........A...........G...........
..............T.................T..............C........A...........G...........
iOPV1
BOL14
BOL17
BOL20
BOL22
bCLA1
bCLA2
bCLA3
bCLA4
bCLA6
bCLA7
bCLA8
bCLA9
bCLA10
bGEOOute1
bGEOKid1
bGEOKid2
bGEOKid3
bGEOKid4
bGEORid1
bGEORid2
bGEORid3
bGEORid4
bGEORid5
bGEORid6
bGEORid7
bGEORid8
bSTELRob1
bSTELRob2
bSTELRob3
bSTELFar1
bSTELFar3
bSTELRos4
bSTELRos5
bSTELRos6
bSTELRos7
bSTELRos8
bSTELRos9
bSTELRos10
bSTELRos11
bPEAsc1
bPEAsc2
bPEAsc3
bPEAsc4
bPEAsc5
bPEAsc6
bPEAsc7
bPEAsc8
bPEAsc9
bPEAsc11
bPEAsc12
bPEAsc13
250
260
270
280
290
300
310
320
....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|
TATTACAACAATTATTAATATACGTCCTGAAGGAATAACTATGGATCGAATACCTTTATTTGTTTGATCAGTATTTATTA
......T..T..............A..A.T..........T.A.............................G..AC.A.
......T..T..............A..A.T..........T.A.............................G..AC.A.
......T..T..............A..A.T..........T.A.............................G..AC.A.
......T..T..............A..A.T..........T.A.............................G..AC.A.
......T..T..............A..A.T..........T.A.............................G..AC.A.
......T..T..............A..A.T..........T.A.............................G..AC.A.
......T..T..............A..A.T..........T.A.............................G..AC.A.
......T..T..............A..A.T..........T.A.............................G..AC.A.
......T..T..............A..A.T..........T...............................G..AC.A.
......T..T..............A..A.T..........T...............................G..AC.A.
......T..T..............A..A.T..........T...............................G..AC.A.
......T..T..............A..A.T..........T.A.............................G..AC.A.
......T..T..............A..A.T..........T.A.............................G..AC.A.
......T..T..............A..A.T..........T.A.............................G..AC.A.
......T.................A..A............T...............................G..AC.A.
......T..T..............A..A............T...............................G..AC.A.
......T..T..............A..A.T..........T.A.............................G..AC.A.
......T.................A..A............T...............................G..AC.A.
......T.................A..A............T...............................G..AC.A.
......T..T..............A..A............T...............................G..AC.A.
......T.................A..A............T...............................G..AC.A.
......T.................A..A............T...............................G..AC.A.
......T..T..............A..A............T...............................G..AC.A.
......T.................A..A............T...............................G..AC.A.
......T..T..............A..A.T..........T.A.............................G..AC.A.
......T..T..............A..A.T..........T.A.............................G..AC.A.
......T..T..............A..A.T..........T.A.............................G..AC.A.
......T..T..............A..A.T..........T.A.............................G..AC.A.
......T..T..............A..A.T..........T.A.............................G..AC.A.
......T..T..............A..A.T..........T.A.............................G..AC.A.
......T..T..............A..A.T..........T.A.............................G..AC.A.
......T..T..............A..A.T..........T.A.............................G..AC.A.
......T..T..............A..A.T..........T.A.............................G..AC.A.
......T..T..............A..A.T..........T.A.............................G..AC.A.
......T..T..............A..A.T..........T.A.............................G..AC.A.
......T..T..............A..A.T..........T.A.............................G..AC.A.
......T..T..............A..A.T..........T.A.............................G..AC.A.
......T..T..............A..A.T..........T.A.............................G..AC.A.
......T..T..............A..A.T..........T.A.............................G..AC.A.
......T..T..............A..A.T..........T.A.............................G..AC.A.
......T..T..............A..A.T..........T.A.............................G..AT.A.
......T..T..............A..A.T..........T.A.............................G..AC.A.
......T..T.................A............................................G..AC.A.
......T..T..............A..A............T...............................G..AC.A.
......T..T..............A..A.T..........T.A.............................G..AC.A.
......T..T..............A..A.T..........T.A.............................G..AT.A.
......T..T..............A..A.T..........T.A.............................G..AC.A.
......T..T..............A..A.T..........T.A.............................G..AC.A.
......T..T.................A............................................G..AC.A.
......T..T..............A..A............T...............................G..AC.A.
......T..T..............A..A.T..........T.A.............................G..AC.A.
iOPV1
BOL14
BOL17
BOL20
BOL22
bCLA1
bCLA2
bCLA3
bCLA4
330
340
350
360
370
380
390
400
....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|
CAGCTATTTTATTACTTTTATCTTTACCTGTGTTAGCAGGGGCTATTACAATATTATTAACAGATCGGAATATTAATACT
.............GT.A.....A.....A..T........A........T........G..T.....A..C.........
.............GT.A.....A.....A..T........A........T........G..T.....A..C.........
.............GT.A.....A.....A..T........A........T........G..T.....A..C.........
.............GT.A.....A.....A..T........A........T........G..T.....A..C.........
.............GT.A.....A.....A..T........A........T........G..T.....A..C.........
.............GT.A.....A.....A..T........A........T........G..T.....A..C.........
.............GT.A.....A.....A..T........A........T........G..T.....A..C.........
.............GT.A.....A.....A..T........A........T........G..T.....A..C.........
103
bCLA6
bCLA7
bCLA8
bCLA9
bCLA10
bGEOOute1
bGEOKid1
bGEOKid2
bGEOKid3
bGEOKid4
bGEORid1
bGEORid2
bGEORid3
bGEORid4
bGEORid5
bGEORid6
bGEORid7
bGEORid8
bSTELRob1
bSTELRob2
bSTELRob3
bSTELFar1
bSTELFar3
bSTELRos4
bSTELRos5
bSTELRos6
bSTELRos7
bSTELRos8
bSTELRos9
bSTELRos10
bSTELRos11
bPEAsc1
bPEAsc2
bPEAsc3
bPEAsc4
bPEAsc5
bPEAsc6
bPEAsc7
bPEAsc8
bPEAsc9
bPEAsc11
bPEAsc12
bPEAsc13
.............G..A.....A.....A...........A........T........G..T........C.........
.............G..A.....A.....A....................T........G..T........C.........
.............G..A.....A.....A...........A........T........G..T........C.........
.............GT.A.....A.....A..T........A........T........G..T.....A..C.........
.............GT.A.....A.....A..T........A........T........G..T.....A..C.........
.............GT.A.....A.....A..T........A........T........G..T.....A..C.........
.............G..A.....A.....A....................T........G..T.....A..C.........
.............G..A.....A.....A...........A........T........G..T........C.........
.............G..A.....A.....A...........A........T........G..T........C.........
.............G..A.....A.....A....................T........G..T.....A..C.........
.............G..A.....A.....A....................T........G..T.....A..C.........
.............G..A.....A.....A...........A........T........G..T........C.........
.............G..A.....A.....A....................T........G..T.....A..C.........
.............G..A.....A.....A....................T........G..T.....A..C.........
.............G..A.....A.....A...........A........T........G..T........C.........
.............G..A.....A.....A....................T........G..T.....A..C.........
.............G..A.....A.....A...........A........T........G..T........C.........
.............GT.A.....A.....A..T........A........T........G..T.....A..C.........
.............GT.A.....A.....A..T........A........T........G..T.....A..C.........
.............GT.A.....A.....A..T........A........T........G..T.....A..C.........
.............GT.A.....A.....A..T........A........T........G..T.....A..C.........
.............G..A.....A.....A...........A........T........G..T.....A..C.........
.............G..A.....A.....A...........A........T........G..T.....A..C.........
.............GT.A.....A.....A..T........A........T........G..T.....A..C.........
.............G..A.....A.....A...........A........T........G..T.....A..C.........
.............GT.A.....A.....A..T........A........T........G..T.....A..C.........
.............GT.A.....A.....A..T........A........T........G..T.....A..C.........
.............G..A.....A.....A...........A........T........G..T.....A..C.........
.............GT.A.....A.....A..T........A........T........G..T.....A..C.........
.............GT.A.....A.....A..T........A........T........G..T.....A..C.........
.............GT.A.....A.....A..T........A........T........G..T.....A..C.........
.............GT.A.....A.....A..T........A........T........G..T.....A..C.........
.............GT.A.....A.....A..T........A........T........G..T.....A..C.........
.............GT.A.....A.....A..T........A........T........G..T.....A..C.........
.............G..A.....A.....A....................T........G..T........C.........
.............G..A.....A.....A....................T........G..T.....A..C.........
.............GT.A.....A.....A..T........A........T........G..T.....A..C.........
.............GT.A.....A.....A..T........A........T........G..T.....A..C.........
.............GT.A.....A.....A..T........A........T........G..T.....A..C.........
.............GT.A.....A.....A..T........A........T........G..T.....A..C.........
.............G..A.....A.....A....................T........G..T........C.........
.............G..A.....A.....A....................T........G..T.....A..C.........
.............GT.A.....A.....A..T........A........T........G..T.....A..C.........
iOPV1
BOL14
BOL17
BOL20
BOL22
bCLA1
bCLA2
bCLA3
bCLA4
bCLA6
bCLA7
bCLA8
bCLA9
bCLA10
bGEOOute1
bGEOKid1
bGEOKid2
bGEOKid3
bGEOKid4
bGEORid1
bGEORid2
bGEORid3
bGEORid4
bGEORid5
bGEORid6
bGEORid7
bGEORid8
bSTELRob1
bSTELRob2
bSTELRob3
bSTELFar1
410
420
430
440
450
460
470
480
....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|
TCCTTTTTTGATCCAGCAGGAGGGGGAGATCCTATTTTATACCAACATTTATTTTGATTTTTTGGGCACCCA-------..A........C..T........A..G.....A........T..G....................T..T...-------..A........C..T........A..G.....A........T..G....................T..T...-------..A........C..T........A..G.....A........T..G....................T..T...-------..A........C..T........A..G.....A........T..G....................T..T...-------..A........C..T........A..G.....A........T..G....................T..T...-------..A........C..T........A..G.....A........T..G....................T..T...-------..A........C..T........A..G.....A........T..G....................T..T...-------..A........C..T........A..G.....A........T..G....................T..T... ------...........C..T........A..G.....A...........G...........................-------...........C..T........A..G.....A...........G...........................-------...........C..T........A..G.....A...........G...........................-------..A........C..T........A..G.....A........T..G....................T..T...-------..A........C..T........A..G.....A........T..G....................T..T...-------..A........C..T........A..G.....A........T..G....................T..T...-------...........C..T........A..G.....A...........G...........................-------...........C..T........A..G.....A...........G...........................-------...........C..T........A..G.....A...........G...........................-------...........C..T........A..G.....A...........G...........................-------...........C..T........A..G.....A...........G...........................-------...........C..T........A..G.....A...........G...........................-------...........C..T........A..G.....A...........G...........................-------...........C..T........A..G.....A...........G...........................-------...........C..T........A..G.....A...........G...........................-------...........C..T........A..G.....A...........G...........................-------...........C..T........A..G.....A...........G...........................-------..A........C..T........A..G.....A........T..G....................T..T...-------..A........C..T........A..G.....A........T..G....................T..T...-------..A........C..T........A..G.....A........T..G....................T..T...-------..A........C..T........A..G.....A........T..G....................T..T...-------...........C..T........A..G.....A...........G...........................--------
104
bSTELFar3
bSTELRos4
bSTELRos5
bSTELRos6
bSTELRos7
bSTELRos8
bSTELRos9
bSTELRos10
bSTELRos11
bPEAsc1
bPEAsc2
bPEAsc3
bPEAsc4
bPEAsc5
bPEAsc6
bPEAsc7
bPEAsc8
bPEAsc9
bPEAsc11
bPEAsc12
bPEAsc13
...........C..T........A..G.....A...........G...........................-------..A........C..T........A..G.....A........T..G....................T..T...-------...........C..T........A..G.....A...........G...........................-------..A........C..T........A..G.....A........T..G....................T..T...-------..A........C..T........A..G.....A........T..G....................T..T...-------...........C..T........A..G.....A...........G...........................-------..A........C..T........A..G.....A........T..G....................T..T...-------..A........C..T........A..G.....A........T..G....................T..T...-------..A........C..T........A..G.....A........T..G....................T..T...-------..A........C..T........A..G.....A........T..G....................T..T...-------..A........C..T........A..G.....A........T..G....................T..T...-------..A........C..T........A..G.....A........T..G....................T..T...-------...........C..T........A..G.....A...........G...........................-------...........C..T........A..G.....A.......................................-------..A........C..T........A..G.....A........T..G....................T..T...-------..A........C..T........A..G.....A........T..G....................T..T...-------..A........C..T........A..G.....A........T..G....................T..T...-------..A........C..T........A..G.....A........T..G....................T..T...-------...........C..T........A..G.....A...........G...........................-------...........C..T........A..G.....A.......................................-------..A........C..T........A..G.....A........T..G....................T..T...--------
105
Appendix 4
Multiple sequences alignment of the C. imicola and C. bolitinos nucleotide sequences of the 16S
rRNA partial gene fragment for all individuals midges from all sampled populations. Culicoides
tuttifrutti (tuttiNHMT15) sequence was used to align both C. imicola and C. bolitinos. All the
nucleotide sites that are similar to TUT1 are represented by the dots. The alignment was used to
compare the two species of Culicoides. All the names of the sequences that were obtained from
the GenBank start with capital letters. The alignment was carried out using the Clustal X program.
The prefix i represents C. imicola and b represents C. bolitinos. The symbol (-) indicates deletions.
106
tuttiNHMT15
OPRSA1
OPRSA2
OPRSA6
OPRSA10
OPNHM16I
OPNHM17I
OPNHM18I
OPNHM19I
OPAOND1
OPAOND2
OPAOND6
OPAOND10
IBET15
IBET18
IBET31
IBET35
IBET45
iOPV1
iOPV4
iOPV5
iOPV6
iOPV7
iOPV8
iOPV10
iOPV12
iKP1
iOPV13
iOPV14
iOPV15
iStelRiv1
iStelRiv2
iStelKun3
iStelBea2
iStelTr2
iStelRiv4
iStelKun1
iStelBon1
iStelBon4
iStelKen4
iStelKen1
iStelRob1
iStelRob2
iStelRob3
iUITWic11
iUITWic12
iUITWic13
iUITWic14
iUITWic15
iUITWic16
iUITWic17
iUITWic18
iUITWic19
iUITWic20
iUITWic21
iUITWic22
iUITWic23
bCLA8
bCLA9
bCLA10
bCLA11
bCLA12
bCLA13
bCLA14
bCLA15
bCLA16
bCLA17
bCLA18
bCLA19
bCLA20
bGEO4
bGEO6
bGEO7
bGEO8
bGEO9
10
20
30
40
50
60
70
80
....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|
CTGTGCAAAGGTAGCATAATCCATTGTCTTTTAATTAAAGGCTAGTATGAATGGTTGGATGAGATATC
.....................T.....................T.............A.........T
.....................T.....................T.............A.........T
.....................T.....................T.............A.........T
.....................T.....................T.............A.........T
.....................T.....................T.............A.........T
.....................T.....................T.............A.........T
.....................T.....................T.............A.........T
.....................T.....................T.............A.........T
.....................T.....................T.............A.........T
.....................T.....................T.............A.........T
.....................T.....................T.............A.........T
.....................T.....................T.............A.........T
.....................T.....................T.............A.........T
.....................T.....................T.............A.........T
.....................T.....................T.............A.........T
.....................T.....................T.............A.........T
.....................T.....................T.............A.........T
.....................T.....................T.............A.........T
.....................T.....................T.............A.........T
.....................T.....................T.............A.........T
.....................T.....................T.............A.........T
...............C.....T.....................T.............A.........T
...............C.....T.....................T.............A.........T
.....................T.....................T.............A.........T
.....................T.....................T.............A.........T
.CTG.................T.....................T.............A.........T
.CTG.................T.....................T.............A.........T
..TG.................T.....................T.............A.........T
.....................T.....................T.............A.........T
.....................T.....................T.............A.........T
.....................T.....................T.............A.........T
.....................T.....................T.............A.........T
.....................T.....................T.............A.........T
.....................T.....................T.............A.........T
.....................T.....................T.............A.........T
.....................T.....................T.............A.........T
.....................T.....................T.............A.........T
.....................T.....................T.............A.........T
.....................T.....................T.............A.........T
.....................T.....................T.............A.........T
.....................T.....................T.............A.........T
.....................T.....................T.............A.........T
.....................T.....................T.............A.........T
.....................T.....................T.............A.........T
.....................T.....................T.............A.........T
.....................T.....................T.............A.........T
.....................T.....................T.............A.........T
.....................T.....................T.............A.........T
.....................T.....................T.............A.........T
.....................T.....................T.............A.........T
.....................T.....................T.............A.........T
.....................T.....................T.............A.........T
.....................T.....................T.............A.........T
................C....T.....................T.............A.........T
.....................T.....................T.............A.........T
.....................T.....................T.............A.........T
CAGTATACCCGA.................GCAATC.CTGACA..T..........T.............A.........T
CAGTATACCCGA.............................................A.................G....
CAGTATACCCGA.................GCGATC.CTGACA..T..........T.............A.........T
CAGTATACCCGA....................ATC.CTGA.A..T..........T.............A.........T
CAGTATACCCGA....................ATC.CTGA.A.............T.............A.........T
CAGTATACCCGA.............T.........A.TGACA..T..........T.............A.........T
CAGTATACCCGA.............T......ATCA.TGA.A..T..........T.............A.........T
CAGTATACCCGA.............T......ATCC.C.GAA..T..........T.............A.........T
CAGTATACCCGA.............T..............AA..T..........T.............A.........T
CAGTATACCCGA.............T..............AA.............T.....C.......A.........T
CAGTATACCCGA.................GCA.........................A.................G....
CAGTATACCCGA.............................................A.................G....
CAGTATACCCGA.......................C.....................A.................G....
CAGTATACCCGA.............................................A.................G....
CAGTATACCCGA.............................................A.................G....
CAGTATACCCGA................................T............A...........A.........T
CAGTATACCCGA......................................C......A...........A.........T
CAGTATACCCGA.............................................A...........A.........T
107
bGEO10
bGEO11
bGEO12
bGEO13
bGEO14
bGEO1
bGEO3
bGEO5
bStelRos1
bStelRos2
bStelRos3
bStelRos4
bStelRos5
bStelRos6
bStelRos7
bStelRos9
bStelRos10
bStelRob1
bStelFar1
bStelFar2
bPEAsc7
bPEAsc8
bPEAsc9
bPEAsc10
bPEAsc11
bPEAsc12
bPEAsc13
bPEAsc14
bPEAsc16
CAGTATACCCGA.............................................A.................G....
CAGTATACCCGA................................T............A...........A.........T
CAGTATACCCGA......................................C......A.................G....
CAGTATACCCGA......................................C......A...........A.........T
CAGTATACCCGA.............................................A...........A.........T
CAGTATACCCGA.............................................A.................G....
CAGTATACCCGA.............................................A.................G....
CAGTATACCCGA.............................................A.................G....
CAGTATACCCGA.............................................A.................G....
CAGTATACCCGA................................T............A...........A.........T
CAGTATACCCGA.............................................A.................G....
CAGTATACCCGA..........................A.A................A...........A.........T
CAGTATACCCGA................................T............A...........A.........T
CAGTATACCCGA.............................................A.................G....
CAGTATACCCGA......................CA.....................A.................G....
CAGTATACCCGA.............................................A.................G....
CAGTATACCCGA.............................................A.................G....
CAGTATACCCGA.............................................A.................G....
CAGTATACCCGA.............................................A.................G....
CAGTATACCCGA.............................................A.................G....
CAGTATACCCGA.............................................A.................G....
CAGTATACCTGA.............................................A.................G....
CAGTATACCCGA.............................................A.................G....
CAGTATACCTGA.............................................A.................G....
CAGTATACCCGA.............................................A.................G....
CAGTATACCCGA.............................................A.........G.......G....
CAGTATACCCGA.......................C.....................A.................G....
CAGTATACCCGA.......................C.....................A.................G....
CAGTATACCTGA.......................C.....................A.........G.......G....
tuttiNHMT15
OPRSA1
OPRSA2
OPRSA6
OPRSA10
OPNHM16I
OPNHM17I
OPNHM18I
OPNHM19I
OPAOND1
OPAOND2
OPAOND6
OPAOND10
IBET15
IBET18
IBET31
IBET35
IBET45
iOPV1
iOPV4
iOPV5
iOPV6
iOPV7
iOPV8
iOPV10
iOPV12
iKP1
iOPV13
iOPV14
iOPV15
iStelRiv1
iStelRiv2
iStelKun3
iStelBea2
iStelTr2
iStelRiv4
iStelKun1
iStelBon1
iStelBon4
iStelKen4
iStelKen1
iStelRob1
iStelRob2
iStelRob3
iUITWic11
90
100
110
120
130
140
150
160
....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|
AACTATTTTTATTTTAATAAAAATGAATTTTAATTTTTAGTAAAAATGCTAAAATAAAAAAATTAGACGAGAAGACCCTA
................................................................................
................................................................................
................................................................................
................................................................................
................................................................................
................................................................................
................................................................................
................................................................................
................................................................................
................................................................................
................................................................................
................................................................................
................................................................................
................................................................................
................................................................................
................................................................................
.......................................................................G........
................................................................................
................................................................................
................................................................................
................................................................................
..................................................................G.............
....TCC.........................................................................
................................................................................
..................................................................G.............
................................................................................
................................................................................
................................................................................
................................................................................
................................................................................
................................................................................
................................................................................
................................................................................
................................................................................
................................................................................
................................................................................
................................................................................
................................................................................
................................................................................
................................................................................
................................................................................
................................................................................
................................................................................
................................................................................
108
iUITWi12
iUITWic13
iUITWic14
iUITWic15
iPEWic16
iUITWic17
iUITWic18
iUITWic19
iUITWic20
iUITWic21
iUITWic22
iUITWic23
bCLA8
bCLA9
bCLA10
bCLA11
bCLA12
bCLA13
bCLA14
bCLA15
bCLA16
bCLA17
bCLA18
bCLA19
bCLA20
bGEO4
bGEO6
bGEO7
bGEO8
bGEO9
bGEO10
bGEO11
bGEO12
bGEO13
bGEO14
bGEO1
bGEO3
bGEO5
bStelRos1
bStelRos2
bStelRos3
bStelRos4
bStelRos5
bStelRos6
bStelRos7
bStelRos9
bStelRos10
bStelRob1
bStelFar1
bStelFar2
bPEAsc7
bPEAsc8
bPEAsc9
bPEAsc10
bPEAsc11
bPEAsc12
bPEAsc13
bPEAsc14
bPEAsc16
................................................................................
................................................................................
................................................................................
................................................................................
................................................................................
................................................................................
................................................................................
................................................................................
................................................................................
................................................................................
................................................................................
................................................................................
.....C.............................................C............................
................................................................................
.....C..........................................................................
................................................................................
....C...........................................................................
....C...........................................................................
....C...........................................................................
................................................................................
....C...........................................................................
.....C..........................................................................
................................................................................
................................................................................
................................................................................
................................................................................
................................................................................
TC..............................................................................
TC...C..................................C.......................................
TC..............................................................................
................................................................................
TC..............................................................................
.....C............................................C.............................
TC...C..................................C.......................................
TC..............................................................................
................................................................................
................................................................................
................................................................................
................................................................................
TC..............................................................................
................................................................................
TC..............................................................................
TC..............................................................................
................................................................................
................................................................................
................................................................................
................................................................................
................................................................................
................................................................................
................................................................................
................................................................................
................................................................................
................................................................................
................................................................................
................................................................................
................................................................................
................................................................................
................................................................................
.......................GA.......................................................
tuttiNHMT15
OPRSA1
OPRSA2
OPRSA6
OPRSA10
OPNHM16I
OPNHM17I
OPNHM18I
OPNHM19I
OPAOND1
OPAOND2
OPAOND6
OPAOND10
IBET15
IBET18
170
180
190
200
210
220
230
240
....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|
TAAATCTTTATTTTATAAATAATAATATTAATTTTGTAAATTTTTTAATAATTATTTTTAAAAAATTTTATTGGGAGGAT
........A.......TTT.T...............A........A.TA......AAAA.T...................
........A.......TTT.T...............A........A.TA......AAAA.T...................
........A.......TTT.T...............A........A.TA......AAAA.T...................
........A.......TTT.T...............A........A.TA......AAAA.T...................
........A.......TTT.T...............A........A.TA......AAAA.T...................
........A.......TTT.T...............A........A.TA......AAAA.T...................
........A.......TTT.T...............A........A.TA......AAAA.T...................
........A.......TTT.T...............A........A.TA......AAAA.T...................
........A.......TTT.T...............A........A.TA......AAAA.T...................
........A.......TTT.T...............A........A.TA......AAAA.T...................
........A.......TTT.T...............A........A.TA......AAAA.T...................
........A.......TTT.T...............A........A.TA......AAAA.T...................
........A.......TTT.T...............A........A.TA......AAAA.T...................
........A.......TTT.T...............A........A.TA......AAAA.T...................
109
IBET31
IBET35
IBET45
iOPV1
iOPV4
iOPV5
iOPV6
iOPV7
iOPV8
iOPV10
iOPV12
iKP1
iOPV13
iOPV14
iOPV15
iStelRiv1
iStelRiv2
iStelKun3
iStelBea2
iStelTr2
iStelRiv4
iStelKun1
iStelBon1
iStelBon4
iStelKen4
iStelKen1
iStelRob1
iStelRob2
iStelRob3
iUITWic11
iUITWi12
iUITWic13
iUITWic14
iUITWic15
iUITWic16
iUITWic17
iUITWic18
iUITWic19
iUITWic20
iUITWic21
iUITWic22
iUITWic23
bCLA8
bCLA9
bCLA10
bCLA11
bCLA12
bCLA13
bCLA14
bCLA15
bCLA16
bCLA17
bCLA18
bCLA19
bCLA20
bGEO4
bGEO6
bGEO7
bGEO8
bGEO9
bGEO10
bGEO11
bGEO12
bGEO13
bGEO14
bGEO1
bGEO3
bGEO5
bStelRos1
bStelRos2
bStelRos3
bStelRos4
bStelRos5
bStelRos6
bStelRos7
bStelRos9
bStelRos10
........A.......TTT.T...............A........A.TA......AAAA.T...................
........A.......TTT.T...............A........A.TA......AAAA.T...................
........A.......TTT.T...............A........A.TA......AAAA.T...................
........A.......TTT.T...............A........A.TA......AAAA.T...................
........A.......TTT.T...............A........A.TA......AAAA.T...................
........A.......TTT.T...............A........A.TA......AAAA.T...................
........A.......TTT.T...............A........A.TA......AAAA.T...................
........A.......TTT.T...............A........A.TA......AAAA.T...................
........A.......TTT.T...............A........A.TA......AAAA.T...................
........A.......TTT.T...............A........A.TA......AAAA.T...................
........A.......TTT.T...............A........A.TA......AAAA.T...................
........A.......TTT.T...............A........A.TA......AAAA.T...................
........A.......TTT.T...............A........A.TA......AAAA.T...................
........A.......TTT.T...............A........A.TA......AAAA.T...................
........A.......TTT.T...............A........A.TA......AAAA.T...................
........A.......TTT.T...............A........A.TA......AAAA.T...................
........A.......TTT.T...............A........A.TA......AAAA.T...................
........A.......TTT.T...............A........A.TA......AAAA.T...................
........A.......TTT.T...............A........A.TA......AAAA.T...................
........A.......TTT.T...............A........A.TA......AAAA.T...................
........A.......TTT.T...............A........A.TA......AAAA.T...................
........A.......TTT.T...............A........A.TA......AAAA.T...................
........A.......TTT.T...............A........A.TA......AAAA.T...................
........A.......TTT.T...............A........A.TA......AAAA.T...................
........A.......TTT.T...............A........A.TA......AAAA.T...................
........A.......TTT.T...............A........A.TA......AAAA.T...................
........A.......TTT.T...............A........A.TA......AAAA.T...................
........A.......TTT.T...............A........A.TA......AAAA.T...................
........A.......TTT.T...............A........A.TA......AAAA.T...................
........A.......TTT.T...............A........A.TA......AAAA.T...................
........A.......TTT.T...............A........A.TA......AAAA.T...................
........A.......TTT.T...............A........A.TA......AAAA.T...................
........A.......TTT.T...............A........A.TA......AAAA.T...................
........A.......TTT.T...............A........A.TA......AAAA.T...................
........A.......TTT.T...............A........A.TA......AAAA.T...................
........A.......TTT.T...............A........A.TA......AAAA.T...................
........A.......TTT.T...............A........A.TA......AAAA.T...................
........A.......TTT.T...............A........A.TA......AAAA.T...................
........A.......TTT.T...............A........A.TA......AAAA.T...................
........A.......TTT.T...............A........A.TA......AAAA.T...................
........A.......TTT.T...............A........A.TA......AAAA.T...................
........A.......TTT.T...............A........A.TA......AAAA.T...................
........A.......TTT.T...............A........A.TA......AAAA.T...................
...................A.........................A.T..G........C....................
........A.......TTT.T...............A........A.TA......AAAA.T...................
........A.......TTT.T...............A........A.TA......AAAA.T...................
........A.......TTT.T...............A........A.TA......AAAA.T..........G........
........A.......TTT.T...............A........A.TA......AAAA.T...................
........A.......TTT.T...............A........A.TA......AAAA.T...................
........A.......TTT.T...............A........A.TA......AAAA.T...................
........A.......TTT.T...............A........A.TA......AAAA.T...................
........A.......TTT.T...............A........A.TA......AAAA.T...................
...................A.........................A.T..G........C....................
...................A.........................A.T..G........C....................
...................A.........................A.T..G........C....................
...................A.........................A.T..G........C....................
...................A.........................A.T..G........C....................
.................................AA.A.......CA.TA..........T................A...
.................................AA.A.......CA.TA..........T................A...
.................................AA.A.......CA.TA..........T................A...
...................A.........................A.T..G........C....................
.................................AA.A.......CA.TA..........T................A...
...................A.........................A.T..G........C....................
.................................AA.A.......CA.TA..........T................A...
.................................AA.A.......CA.TA..........T................A...
...................A.........................A.T..G........C....................
...................A.........................A.T..G........C....................
...................A.........................A.T..G........C....................
...................A.........................A.T..G........C....................
.................................AA.A.......CA.TA..........T................A...
...................A.........................A.T..G........C....................
.................................AA.A.......CA.TA..........T................A...
.................................AA.A.......CA.TA..........T................A...
...................A.........................A.T..G........C....................
...................A.........................A.T..G........C....................
...................A.........................A.T..G........C....................
...................A.........................A.T..G........C....................
110
bStelRob1
bStelFar1
bStelFar2
bPEAsc7
bPEAsc8
bPEAsc9
bPEAsc10
bPEAsc11
bPEAsc12
bPEAsc13
bPEAsc14
bPEAsc16
...................A.........................A.T..G........C....................
...................A.........................A.T..G........C....................
...................A.........................A.T..G........C....................
...................A.........................A.T..G........C....................
...................A.........................A.T..G........C....................
...................A.........................A.T..G........C....................
...................A.........................A.T..G........C....................
...................A.........................A.T..G........C....................
...................A.........................A.T..G........C....................
...................A.........................A.T..G........C....................
...................A.........................A.T..G........C....................
...................A.........................A.T..G........C....................
tuttiNHMT15
OPRSA1
OPRSA2
OPRSA6
OPRSA10
OPNHM16I
OPNHM17I
OPNHM18I
OPNHM19I
OPAOND1
OPAOND2
OPAOND6
OPAOND10
IBET15
IBET18
IBET31
IBET35
IBET45
iOPV1
iOPV4
iOPV5
iOPV6
iOPV7
iOPV8
iOPV10
iOPV12
iKP1
iOPV13
iOPV14
iOPV15
iStelRiv1
iStelRiv2
iStelKun3
iStelBea2
iStelTr2
iStelRiv4
iStelKun1
iStelBon1
iStelBon4
iStelKen4
iStelKen1
iStelRob1
iStelRob2
iStelRob3
iUITWic11
iUITWic12
iUITWic13
iUITWic14
iUITWic15
iUITWic16
iUITWic17
iUITWic18
iUITWic19
iUITWic20
iUITWic21
iUITWic22
iUITWic23
bCLA8
bCLA9
bCLA10
bCLA11
bCLA12
250
260
270
280
290
300
310
320
....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|
AATGAAATTTAATAAACTTTTATTCTAATTT-ATAAATATAATTAAATTAATGAATATATTATTATAAAATGTTTAAAAA
........................T.TT...-..................T.........A..........A........
........................T.TT...-..................T.........A..........A........
........................T.TT...-..................T.........A..........A........
........................T.TT...-..................T.........A..........A........
........................T.TT...-..................T.........A..........A........
........................T.TT...-..................T.........A..........A........
........................T.TT...-..................T.........A..........A........
........................T.TT...-..................T.........A..........A........
........................T.TT...-..................T.........A..........A........
........................T.TT...-..................T.........A..........A........
........................T.TT...-..................T.........A..........A........
........................T.TT...-..................T.........A..........A........
........................T.TT...-..................T.........A..........A........
........................T.TT...-..................T.........A..........A........
........................T.TT...-..................T.........A..........A........
........................T.TT...-..................T.........A..........A........
........................T.TT...-..................T.........A..........A........
........................T.TT...-..................T.........A..........A........
........................T.TT...-..................T.........A..........A........
........................T.TT...-..................T.........A..........A........
........................T.TT...-..................T.........A..........A........
........................T.TT...-..................T.........A..........A........
........................T.TT...-..................T.........A..........A........
........................T.TT...-..................T.........A..........A........
........................T.TT...-..................T.........A..........A........
........................T.TT...-..................T.........A..........A........
........................T.TT...-..................T.........A..........A........
........................T.TT...-..................T.........A..........A........
........................T.TT...-..................T.........A..........A........
........................T.TT...-..................T.........A..........A........
........................T.TT...-..................T.........A..........A........
........................T.TT...-..................T.........A..........A........
........................T.TT...-..................T.........A..........A........
........................T.TT...-..................T.........A..........A........
........................T.TT...-..................T.........A..........A........
........................T.TT...-..................T.........A..........A........
........................T.TT...-..................T.........A..........A........
........................T.TT...-..................T.........A..........A........
........................T.TT...-..................T.........A..........A........
........................T.TT...-..................T.........A..........A........
........................T.TT...-..................T.........A..........A........
........................T.TT...-..................T.........A..........A........
........................T.TT...-..................T.........A..........A........
........................T.TT...-..................T.........A..........A........
........................T.TT...-..................T.........A..........A........
........................T.TT...-..................T.........A..........A........
........................T.TT...-..................T.........A..........A........
........................T.TT...-..................T.........A..........A........
........................T.TT...-..................T.........A..........A........
........................T.TT...-..................T.........A..........A........
........................T.TT...-..................T.........A..........A........
........................T.TT...-..................T.........A..........A........
........................T.TT...-..................T.........A..........A........
........................T.TT...-..................T.........A..........A........
........................T.TT...-..................T.........A..........A........
........................T.TT...-..................T.........A..........A........
........................T.TT...T..................TG........A..........A........
........................T..T...T............................A...................
........................T.TT...T..................TG........A..........A........
........................T.TT...T..................TG........A..........A........
........................T.TT...T..................TG........A..........A........
111
bCLA13
bCLA14
bCLA15
bCLA16
bCLA17
bCLA18
bCLA19
bCLA20
bGEO4
bGEO6
bGEO7
bGEO8
bGEO9
bGEO10
bGEO11
bGEO12
bGEO13
bGEO14
bGEO1
bGEO3
bGEO5
bStelRos1
bStelRos2
bStelRos3
bStelRos4
bStelRos5
bStelRos6
bStelRos7
bStelRos9
bStelRos10
bStelRob1
bStelFar1
bStelFar2
bPEAsc7
bPEAsc8
bPEAsc9
bPEAsc10
bPEAsc11
bPEAsc12
bPEAsc13
bPEAsc14
bPEAsc16
........................T.TT...T..................TG........A..........A........
........................T.TT...T..................TG........A..........A........
........................T.TT...T..................TG........A..........A........
........................T.TT...T..................TG........A..........A........
........................T.TT...T..................TG........A...G......A........
........................T..T...T............................A...................
........................T..T...T............................A...................
........................T..T...T............................A...................
........................T..T...T............................A...T...............
........................T..T...T............................A...T...............
..........T.A...........T.G....T..............T...T.........A...T......A........
..........T.A...........T.G....T..............T...T.........A...T......A........
..........T.A...........T.G....T..............T...T.........A...T......A........
........................T..T...T............................A...T...............
..........T.A...........T.G....T..............T...T.........A...T......A........
..G.....................T..T...T.......................GG...A...T...............
..........T.A...........T.G....T..............T...T.........A...T......A........
..........T.A...........T.G....T..............T...T.........A...T......A........
........................T..T...T............................A...T...............
........................T..T...T............................A...T...............
........................T..T...T............................A...T...............
........................T..T...T............................A...T...............
..........T.A...........T.G....T..............T...T.........A...T......A........
........................T..T...T............................A...T...............
..........T.A...........T.G....T..............T...T.........A...T......A........
..........T.A...........T.G....T..............T...T.........A...T......A........
........................T..T...T............................A...T...............
........................T..T...T............................A...T...............
........................T..T...T............................A...T...............
........................T..T...T............................A...T...............
........................T..T...T............................A...T...............
........................T..T...T............................A...T...............
........................T..T...T............................A...T...............
........................T..T...T............................A...T...............
........................T..T...T............................A...T...............
........................T..T...T............................A...T...............
........................T..T...T............................A...T...............
........................T..T...T............................A...T...............
........................T..T...T............................A...T...............
........................T..T...T............................A...T...............
........................T..T...T............................A...T...............
........................T..T...T............................A...T...............
tuttiNHMT15
OPRSA1
OPRSA2
OPRSA6
OPRSA10
OPNHM16I
OPNHM17I
OPNHM18I
OPNHM19I
OPAOND1
OPAOND2
OPAOND6
OPAOND10
IBET15
IBET18
IBET31
IBET35
IBET45
iOPV1
iOPV4
iOPV5
iOPV6
iOPV7
iOPV8
iOPV10
iOPV12
iKP1
iOPV13
iOPV14
iOPV15
iStelRiv1
iStelRiv2
330
340
350
360
370
380
390
400
....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|
ATTAAGTTACTTTAGGGATAACAGCGTAATTATTTTAAAGAGTTCTTATCGACAAAATAGTTTGCGACCTCGATGTTGAA
....................................................T...........................
....................................................T...........................
....................................................T...........................
....................................................T...........................
....................................................T...........................
....................................................T...........................
....................................................T...........................
....................................................T...........................
....................................................T...........................
....................................................T...........................
....................................................T...........................
....................................................T...........................
....................................................T..................C........
....................................................T...........................
....................................................T...........................
....................................................T...........................
....................................................T...........................
....................................................T...........................
....................................................T...........................
....................................................T...........................
....................................................T...........................
....................................................T...........................
....................................................T...........................
....................................................T...........................
....................................................T...........................
....................................................T...........................
....................................................T...........................
........C...........................................T.............C..C..........
....................................................T...........................
....................................................T...........................
....................................................T...........................
112
iStelKun3
iStelBea2
iStelTr2
iStelRiv4
iStelKun1
iStelBon1
iStelBon4
iStelKen4
iStelKen1
iStelRob1
iStelRob2
iStelRob3
iUITWic11
iUITWi12
iUITWic13
iUITWic14
iUITWic15
iUITWic16
iUITWic17
iUITWic18
iUITWic19
iUITWic20
iUITWic21
iUITWic22
iUITWic23
bCLA8
bCLA9
bCLA10
bCLA11
bCLA12
bCLA13
bCLA14
bCLA15
bCLA16
bCLA17
bCLA18
bCLA19
bCLA20
bGEO4
bGEO6
bGEO7
bGEO8
bGEO9
bGEO10
bGEO11
bGEO12
bGEO13
bGEO14
bGEO1
bGEO3
bGEO5
bStelRos1
bStelRos2
bStelRos3
bStelRos4
bStelRos5
bStelRos6
bStelRos7
bStelRos9
bStelRos10
bStelRob1
bStelFar1
bStelFar2
bPEAsc7
bPEAsc8
bPEAsc9
bPEAsc10
bPEAsc11
bPEAsc12
bPEAsc13
bPEAsc14
bPEAsc16
....................................................T...........................
....................................................T...........................
....................................................T...........................
....................................................T...........................
....................................................T...........................
....................................................T...........................
....................................................T...........................
....................................................T...........................
....................................................T.....T.....................
....................................................T...........................
........C...........................................T.........G......C..........
....................................................T...........................
....................................................T.........G......C..........
....................................................T...........................
....................................................T...........................
....................................................T...........................
....................................................T.........G......C..........
....................................................T...........................
....................................................T...........................
....................................................T...........................
....................................................T...........................
....................................................T...........................
....................................................T...........................
....................................................T...........................
....................................................T.........G......C..........
....G...C...........................................T...........................
....................................................T...........................
....G...C...........................................T...........................
........C...........................................T...........................
........C...........................................T...........................
........C...........................................T...........................
........C...........................................T...........................
........C...........................................T...........................
........C...........................................T...........................
....G...C...........................................T...........................
....................................................T...........................
....................................................T...........................
....................................................T...........................
....................................................T...........................
....................................................T...........................
.....................................G....C.........T.....T.....................
.....................................G....C.........T.....T.....................
.....................................G....C.........T.....T.....................
....................................................T...........................
.....................................G....C.........T.....T.....................
....................................................T.................A.........
.....................................G....C.........T.....T.....................
.....................................G....C.........T.....T.....................
....................................................T...........................
....................................................T...........................
....................................................T...........................
....................................................T...........................
.....................................G....C.........T.....T.....................
....................................................T...........................
.....................................G....C.........T.....G.....................
.....................................G....C.........T.....T.....................
....................................................T...........................
....................................................T...........................
....................................................T...........................
....................................................T...........................
....................................................T...........................
....................................................T...........................
....................................................T...........................
....................................................T...........................
....................................................T...........................
....................................................T...........................
....................................................T...........................
....................................................T...........................
..........................................A.........T...........................
....................................................T...........................
....................................................T...........................
....................................................T...........................
113
tuttiNHMT15
OPRSA1
OPRSA2
OPRSA6
OPRSA10
OPNHM16I
OPNHM17I
OPNHM18I
OPNHM19I
OPAOND1
OPAOND2
OPAOND6
OPAOND10
IBET15
IBET18
IBET31
IBET35
IBET45
iOPV1
iOPV4
iOPV5
iOPV6
iOPV7
iOPV8
iOPV10
iOPV12
iKP1
iOPV13
iOPV14
iOPV15
iStelRiv1
iStelRiv2
iStelKun3
iStelBea2
iStelTr2
iStelRiv4
iStelKun1
iStelBon1
iStelBon4
iStelKen4
iStelKen1
iStelRob1
iStelRob2
iStelRob3
iUITWic11
iUITWic12
iUITWic13
iUITWic14
iUITWic15
iUITWic16
iUITWic17
iUITWic18
iUITWic19
iUITWic20
iUITWic21
iUITWic22
iUITWic23
bCLA8
bCLA9
bCLA10
bCLA11
bCLA12
bCLA13
bCLA14
bCLA15
bCLA16
bCLA17
bCLA18
bCLA19
bCLA20
bGEO4
bGEO6
bGEO7
bGEO8
bGEO9
410
420
430
440
450
....|....|....|....|....|....|....|....|....|....|....|...
TTAAGAATTAATTTAGGTGCAGAAATTTAAATTTTAAGTCTGTTCGACTTTTAAATTC
...................T....G...........................G.....
...................T.C..G...........................G.....
...................T....G...........................G.....
...................T....G...........................G.....
...................T....G...........................G.....
...................T....G...........................G.....
...................T....G...........................G.....
...................T....G...........................G.....
...................T....G...........................G.....
...................T.C..G...........................G.....
...................T....G...........................G.....
...................T....G...........................G.....
...................T....G...........................G...C.
...................T.A..G...........................G.....
...................T.T..G...........................G.....
...................T....G...........................G.....
...................T....G...........................G...C.
...................T....G...........................G.....
...................T....G...........................G.....
...................T....G.............C.C.......C.GAC.....
...................T....G...........................G.....
.................G.T....G.............C.G..C........G.....
...................T....G...........................G.T.C.
...................T....G...........................G.....
.................G.T....G.............C.G..C........G.....
.................G.T....G.............C.G..C........G.....
.................G.T....G.............C.G..C........G.....
.................G.T....G...........................G.T...
.................G.T....G...........................G.T.C.
...................T....G...........................G.T.C.
...................T....G.............C.............G.T.C.
...................T....G...........................G.T.C.
...................T....G...........................G.T.C.
...................T....G...........................G.T.C.
...................T....G...........................G.T.C.
...................T....G...........................G.T.C.
...................T....G...........................G.T.C.
...................T....G..................C........G.T.C.
...................T....G...........................G.T.C.
...................T....G...................GAC.....G.T.C.
...................T....G...........................G.T.C.
.................G.T....G...........................G.T.C.
...................T....G...........................G.T.C.
.................G.T....G...............G...........G.T.C.
...................T....G...........................G.T.C.
.................G.T....G...........................G.T.C.
...................T....G...........................G.T.C.
.................G.T....G...............G...........G.T.C.
...................T...CGGC.........................G.T.C.
...................T....G...........................G.T.C.
...................T....G...........................G.T.C.
...................T....G...........................G.T.C.
...................T....G...........................G.T.C.
.................G.T....G...........................G.T.C.
...................T....G...........................G.T.C.
.................G.T....G...............G...........G.T.C.
......G.A..........T....G.....................
......G.A..........T....G.....................
......G.A..........T....G.....................
......G.A..........T....G.....................
......G.A..........T....G.....................
......G.A..........T....G.....................
......G.A..........T....G.....................
......G.A..........T....G.....................
......G.A..........T....G.....................
......G.A..........T....G.....................
......G.A..........T....G.....................
......G.A..........T....G.....................
......G.A..........T....G.....................
......G.A..........T....G.....................
......G.A..........A....G.....................
...............AA....A..G.....................
.............A.A.CAA.A..G.....................
...............AA....A..G.....................
114
bGEO10
bGEO11
bGEO12
bGEO13
bGEO14
bGEO1
bGEO3
bGEO5
bStelRos1
bStelRos2
bStelRos3
bStelRos4
bStelRos5
bStelRos6
bStelRos7
bStelRos9
bStelRos10
bStelRob1
bStelFar1
bStelFar2
bPEAsc7
bPEAsc8
bPEAsc9
bPEAsc10
bPEAsc11
bPEAsc12
bPEAsc13
bPEAsc14
bPEAsc16
......G.A..........A....G.....................
...............AA....A..G.....................
......G..............A..G.....................
.............A.A.CAA.A..G.....................
...............AA....A..G.....................
......G.A..........T....G.....................
......G.A..........T....G.....................
......G.A..........T....G.....................
......G.A..........T....G.....................
...............AA....A..G.....G...............
......G.A..........T....G.....................
.............A.A.CA.CA..G.....................
...............AA....A..G.....................
......G.A..........T....G.....................
......G.A..........T....G...............C.....
......G.A..........T....G.....................
......G.A..........T....G.....................
......G.A..........T....G.....................
......G.A..........T....G.....................
......G.A..........T....G.....................
......G.A..........T....G.....................
......G.A..........T....G.....................
......G.A..........T....G.....................
......G.A..........T....G.....................
......G.A..........T....G.....................
......G.A..........T....G.....................
......G.A..........T....G.....................
......G.A..........T....G.....................
......G.A..........T....G.....................
115
Appendix 5
Multiple alignment of the C. imicola nucleotide sequences of the 16S rRNA partial gene fragment
for all 56 individuals from different geographic areas. Culicoides tuttifrutti (tuttiNHMT15) sequence
was used as reference species to generate the alignments. All the nucleotide sites that are similar
to tuttiNHMT15 are represented by the dots. The alignment was used to compare the C. imicola
individuals of all the sampled populations. The alignment was carried out using the Clustal X
program.
116
tuttiNHMT15
OPRSA1
OPRSA2
OPRSA6
OPRSA10
OPNHM16I
OPNHM17I
OPNHM18I
OPNHM19I
OPAOND1
OPAOND2
OPAOND6
OPAOND10
IBET15
IBET18
IBET31
IBET35
IBET45
iOPV1
iOPV4
iOPV5
iOPV6
iOPV7
iOPV8
iOPV10
iOPV12
iKP1
iOPV13
iOPV14
iOPV15
iStelRiv1
iStelRiv2
iStelKun3
iStelBea2
iStelTr2
iStelRiv4
iStelKun1
iStelBon1
iStelBon4
iStelKen4
iStelKen1
iStelRob1
iStelRob2
iStelRob3
iUITWic11
iUITWic12
iUITWic13
iUITWic14
iUITWic15
iUITWic16
iUITWic17
iUITWic18
iUITWic19
iUITWic20
iUITWic21
iUITWic22
iUITWic23
10
20
30
40
50
60
70
80
....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|
CTGTGCAAAGGTAGCATAATCCATTGTCTTTTAATTAAAGGCTAGTATGAATGGTTGGATGAGATATCAACTATTTTTAT
.....................T.....................T.............A.........T............
.....................T.....................T.............A.........T............
.....................T.....................T.............A.........T............
.....................T.....................T.............A.........T............
.....................T.....................T.............A.........T............
.....................T.....................T.............A.........T............
.....................T.....................T.............A.........T............
.....................T.....................T.............A.........T............
.....................T.....................T.............A.........T............
.....................T.....................T.............A.........T............
.....................T.....................T.............A.........T............
.....................T.....................T.............A.........T............
.....................T.....................T.............A.........T............
.....................T.....................T.............A.........T............
.....................T.....................T.............A.........T............
.....................T.....................T.............A.........T............
.....................T.....................T.............A.........T............
.....................T.....................T.............A.........T............
.....................T.....................T.............A.........T............
.....................T.....................T.............A.........T............
.....................T.....................T.............A.........T............
...............C.....T.....................T.............A.........T............
...............C.....T.....................T.............A.........T....TCC.....
.....................T.....................T.............A.........T............
.....................T.....................T.............A.........T............
.CTG.................T.....................T.............A.........T............
.CTG.................T.....................T.............A.........T............
..TG.................T.....................T.............A.........T............
.....................T.....................T.............A.........T............
.....................T.....................T.............A.........T............
.....................T.....................T.............A.........T............
.....................T.....................T.............A.........T............
.....................T.....................T.............A.........T............
.....................T.....................T.............A.........T............
.....................T.....................T.............A.........T............
.....................T.....................T.............A.........T............
.....................T.....................T.............A.........T............
.....................T.....................T.............A.........T............
.....................T.....................T.............A.........T............
.....................T.....................T.............A.........T............
.....................T.....................T.............A.........T............
.....................T.....................T.............A.........T............
.....................T.....................T.............A.........T............
.....................T.....................T.............A.........T............
.....................T.....................T.............A.........T............
.....................T.....................T.............A.........T............
.....................T.....................T.............A.........T............
.....................T.....................T.............A.........T............
.....................T.....................T.............A.........T............
.....................T.....................T.............A.........T............
.....................T.....................T.............A.........T............
.....................T.....................T.............A.........T............
.....................T.....................T.............A.........T............
................C....T.....................T.............A.........T............
.....................T.....................T.............A.........T............
.....................T.....................T.............A.........T............
tuttiNHMT15
OPRSA1
OPRSA2
OPRSA6
OPRSA10
OPNHM16I
OPNHM17I
OPNHM18I
OPNHM19I
OPAOND1
OPAOND2
OPAOND6
OPAOND10
IBET15
IBET18
90
100
110
120
130
140
150
160
....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|
TTTAATAAAAATGAATTTTAATTTTTAGTAAAAATGCTAAAATAAAAAAATTAGACGAGAAGACCCTATAAATCTTTATT
............................................................................A...
............................................................................A...
............................................................................A...
............................................................................A...
............................................................................A...
............................................................................A...
............................................................................A...
............................................................................A...
............................................................................A...
............................................................................A...
............................................................................A...
............................................................................A...
............................................................................A...
............................................................................A...
117
IBET31
IBET35
IBET45
iOPV1
iOPV4
iOPV5
iOPV6
iOPV7
iOPV8
iOPV10
iOPV12
iKP1
iOPV13
iOPV14
iOPV15
iStelRiv1
iStelRiv2
iStelKun3
iStelBea2
iStelTr2
iStelRiv4
iStelKun1
iStelBon1
iStelBon4
iStelKen4
iStelKen1
iStelRob1
iStelRob2
iStelRob3
iUITWic11
iUITWic12
iUITWic13
iUITWic14
iUITWic15
iUITWic16
iUITWic17
iUITWic18
iUITWic19
iUITWic20
iUITWic21
iUITWic22
iUITWic23
............................................................................A...
............................................................................A...
...........................................................G................A...
............................................................................A...
............................................................................A...
............................................................................A...
............................................................................A...
......................................................G.....................A...
............................................................................A...
............................................................................A...
......................................................G.....................A...
............................................................................A...
............................................................................A...
............................................................................A...
............................................................................A...
............................................................................A...
............................................................................A...
............................................................................A...
............................................................................A...
............................................................................A...
............................................................................A...
............................................................................A...
............................................................................A...
............................................................................A...
............................................................................A...
............................................................................A...
............................................................................A...
............................................................................A...
............................................................................A...
............................................................................A...
............................................................................A...
............................................................................A...
............................................................................A...
............................................................................A...
............................................................................A...
............................................................................A...
............................................................................A...
............................................................................A...
............................................................................A...
............................................................................A...
............................................................................A...
............................................................................A...
tuttiNHMT15
OPRSA1
OPRSA2
OPRSA6
OPRSA10
OPNHM16I
OPNHM17I
OPNHM18I
OPNHM19I
OPAOND1
OPAOND2
OPAOND6
OPAOND10
IBET15
IBET18
IBET31
IBET35
IBET45
iOPV1
iOPV4
iOPV5
iOPV6
iOPV7
iOPV8
iOPV10
iOPV12
iKP1
iOPV13
iOPV14
iOPV15
iStelRiv1
iStelRiv2
170
180
190
200
210
220
230
240
....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|
TTATAAATAATAATATTAATTTTGTAAATTTTTTAATAATTATTTTTAAAAAATTTTATTGGGAGGATAATGAAATTTAA
....TTT.T...............A........A.TA......AAAA.T...............................
....TTT.T...............A........A.TA......AAAA.T...............................
....TTT.T...............A........A.TA......AAAA.T...............................
....TTT.T...............A........A.TA......AAAA.T...............................
....TTT.T...............A........A.TA......AAAA.T...............................
....TTT.T...............A........A.TA......AAAA.T...............................
....TTT.T...............A........A.TA......AAAA.T...............................
....TTT.T...............A........A.TA......AAAA.T...............................
....TTT.T...............A........A.TA......AAAA.T...............................
....TTT.T...............A........A.TA......AAAA.T...............................
....TTT.T...............A........A.TA......AAAA.T...............................
....TTT.T...............A........A.TA......AAAA.T...............................
....TTT.T...............A........A.TA......AAAA.T...............................
....TTT.T...............A........A.TA......AAAA.T...............................
....TTT.T...............A........A.TA......AAAA.T...............................
....TTT.T...............A........A.TA......AAAA.T...............................
....TTT.T...............A........A.TA......AAAA.T...............................
....TTT.T...............A........A.TA......AAAA.T...............................
....TTT.T...............A........A.TA......AAAA.T...............................
....TTT.T...............A........A.TA......AAAA.T...............................
....TTT.T...............A........A.TA......AAAA.T...............................
....TTT.T...............A........A.TA......AAAA.T...............................
....TTT.T...............A........A.TA......AAAA.T...............................
....TTT.T...............A........A.TA......AAAA.T...............................
....TTT.T...............A........A.TA......AAAA.T...............................
....TTT.T...............A........A.TA......AAAA.T...............................
....TTT.T...............A........A.TA......AAAA.T...............................
....TTT.T...............A........A.TA......AAAA.T...............................
....TTT.T...............A........A.TA......AAAA.T...............................
....TTT.T...............A........A.TA......AAAA.T...............................
....TTT.T...............A........A.TA......AAAA.T...............................
118
iStelKun3
iStelBea2
iStelTr2
iStelRiv4
iStelKun1
iStelBon1
iStelBon4
iStelKen4
iStelKen1
iStelRob1
iStelRob2
iStelRob3
iUITWic11
iUITWic12
iUITWic13
iUITWic14
iUITWic15
iUITWic16
iUITWic17
iUITWic18
iUITWic19
iUITWic20
iUITWic21
iUITWic22
iUITWic23
....TTT.T...............A........A.TA......AAAA.T...............................
....TTT.T...............A........A.TA......AAAA.T...............................
....TTT.T...............A........A.TA......AAAA.T...............................
....TTT.T...............A........A.TA......AAAA.T...............................
....TTT.T...............A........A.TA......AAAA.T...............................
....TTT.T...............A........A.TA......AAAA.T...............................
....TTT.T...............A........A.TA......AAAA.T...............................
....TTT.T...............A........A.TA......AAAA.T...............................
....TTT.T...............A........A.TA......AAAA.T...............................
....TTT.T...............A........A.TA......AAAA.T...............................
....TTT.T...............A........A.TA......AAAA.T...............................
....TTT.T...............A........A.TA......AAAA.T...............................
....TTT.T...............A........A.TA......AAAA.T...............................
....TTT.T...............A........A.TA......AAAA.T...............................
....TTT.T...............A........A.TA......AAAA.T...............................
....TTT.T...............A........A.TA......AAAA.T...............................
....TTT.T...............A........A.TA......AAAA.T...............................
....TTT.T...............A........A.TA......AAAA.T...............................
....TTT.T...............A........A.TA......AAAA.T...............................
....TTT.T...............A........A.TA......AAAA.T...............................
....TTT.T...............A........A.TA......AAAA.T...............................
....TTT.T...............A........A.TA......AAAA.T...............................
....TTT.T...............A........A.TA......AAAA.T...............................
....TTT.T...............A........A.TA......AAAA.T...............................
....TTT.T...............A........A.TA......AAAA.T...............................
tuttiNHMT15
OPRSA1
OPRSA2
OPRSA6
OPRSA10
OPNHM16I
OPNHM17I
OPNHM18I
OPNHM19I
OPAOND1
OPAOND2
OPAOND6
OPAOND10
IBET15
IBET18
IBET31
IBET35
IBET45
iOPV1
iOPV4
iOPV5
iOPV6
iOPV7
iOPV8
iOPV10
iOPV12
iKP1
iOPV13
iOPV14
iOPV15
iStelRiv1
iStelRiv2
iStelKun3
iStelBea2
iStelTr2
iStelRiv4
iStelKun1
iStelBon1
iStelBon4
iStelKen4
iStelKen1
iStelRob1
iStelRob2
iStelRob3
iUITWic11
iUITWic12
iUITWic13
iUITWic14
iUITWic15
250
260
270
280
290
300
310
320
....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|
TAAACTTTTATTCTAATTTATAAATATAATTAAATTAATGAATATATTATTATAAAATGTTTAAAAAATTAAGTTACTTT
............T.TT.....................T.........A..........A.....................
............T.TT.....................T.........A..........A.....................
............T.TT.....................T.........A..........A.....................
............T.TT.....................T.........A..........A.....................
............T.TT.....................T.........A..........A.....................
............T.TT.....................T.........A..........A.....................
............T.TT.....................T.........A..........A.....................
............T.TT.....................T.........A..........A.....................
............T.TT.....................T.........A..........A.....................
............T.TT.....................T.........A..........A.....................
............T.TT.....................T.........A..........A.....................
............T.TT.....................T.........A..........A.....................
............T.TT.....................T.........A..........A.....................
............T.TT.....................T.........A..........A.....................
............T.TT.....................T.........A..........A.....................
............T.TT.....................T.........A..........A.....................
............T.TT.....................T.........A..........A.....................
............T.TT.....................T.........A..........A.....................
............T.TT.....................T.........A..........A.....................
............T.TT.....................T.........A..........A.....................
............T.TT.....................T.........A..........A.....................
............T.TT.....................T.........A..........A.....................
............T.TT.....................T.........A..........A.....................
............T.TT.....................T.........A..........A.....................
............T.TT.....................T.........A..........A.....................
............T.TT.....................T.........A..........A.....................
............T.TT.....................T.........A..........A.....................
............T.TT.....................T.........A..........A................C....
............T.TT.....................T.........A..........A.....................
............T.TT.....................T.........A..........A.....................
............T.TT.....................T.........A..........A.....................
............T.TT.....................T.........A..........A.....................
............T.TT.....................T.........A..........A.....................
............T.TT.....................T.........A..........A.....................
............T.TT.....................T.........A..........A.....................
............T.TT.....................T.........A..........A.....................
............T.TT.....................T.........A..........A.....................
............T.TT.....................T.........A..........A.....................
............T.TT.....................T.........A..........A.....................
............T.TT.....................T.........A..........A.....................
............T.TT.....................T.........A..........A.....................
............T.TT.....................T.........A..........A................C....
............T.TT.....................T.........A..........A.....................
............T.TT.....................T.........A..........A.....................
............T.TT.....................T.........A..........A.....................
............T.TT.....................T.........A..........A.....................
............T.TT.....................T.........A..........A.....................
............T.TT.....................T.........A..........A.....................
119
iUITWic16
iUITWic17
iUITWic18
iUITWic19
iUITWic20
iUITWic21
iUITWic22
iUITWic23
............T.TT.....................T.........A..........A.....................
............T.TT.....................T.........A..........A.....................
............T.TT.....................T.........A..........A.....................
............T.TT.....................T.........A..........A.....................
............T.TT.....................T.........A..........A.....................
............T.TT.....................T.........A..........A.....................
............T.TT.....................T.........A..........A.....................
............T.TT.....................T.........A..........A.....................
tuttiNHMT15
OPRSA1
OPRSA2
OPRSA6
OPRSA10
OPNHM16I
OPNHM17I
OPNHM18I
OPNHM19I
OPAOND1
OPAOND2
OPAOND6
OPAOND10
IBET15
IBET18
IBET31
IBET35
IBET45
iOPV1
iOPV4
iOPV5
iOPV6
iOPV7
iOPV8
iOPV10
iOPV12
iKP1
iOPV13
iOPV14
iOPV15
iStelRiv1
iStelRiv2
iStelKun3
iStelBea2
iStelTr2
iStelRiv4
iStelKun1
iStelBon1
iStelBon4
iStelKen4
iStelKen1
iStelRob1
iStelRob2
iStelRob3
iUITWic11
iUITWic12
iUITWic13
iUITWic14
iUITWic15
iUITWic16
iUITWic17
iUITWic18
iUITWic19
iUITWic20
iUITWic21
iUITWic22
iUITWic23
330
340
350
360
370
380
390
400
....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|
AGGGATAACAGCGTAATTATTTTAAAGAGTTCTTATCGACAAAATAGTTTGCGACCTCGATGTTGAATTAAGAATTAATT
.......................................T........................................
.......................................T........................................
.......................................T........................................
.......................................T........................................
.......................................T........................................
.......................................T........................................
.......................................T........................................
.......................................T........................................
.......................................T........................................
.......................................T........................................
.......................................T........................................
.......................................T........................................
.......................................T..................C.....................
.......................................T........................................
.......................................T........................................
.......................................T........................................
.......................................T........................................
.......................................T........................................
.......................................T........................................
.......................................T........................................
.......................................T........................................
.......................................T........................................
.......................................T........................................
.......................................T........................................
.......................................T........................................
.......................................T........................................
.......................................T........................................
.......................................T.............C..C.......................
.......................................T........................................
.......................................T........................................
.......................................T........................................
.......................................T........................................
.......................................T........................................
.......................................T........................................
.......................................T........................................
.......................................T........................................
.......................................T........................................
.......................................T........................................
.......................................T........................................
.......................................T.....T..................................
.......................................T........................................
.......................................T.........G......C.......................
.......................................T........................................
.......................................T.........G......C.......................
.......................................T........................................
.......................................T........................................
.......................................T........................................
.......................................T.........G......C.......................
.......................................T........................................
.......................................T........................................
.......................................T........................................
.......................................T........................................
.......................................T........................................
.......................................T........................................
.......................................T........................................
.......................................T.........G......C.......................
tuttiNHMT15
OPRSA1
OPRSA2
OPRSA6
OPRSA10
OPNHM16I
410
420
430
440
....|....|....|....|....|....|....|....|....|
TAGGTGCAGAAATTTAAATTTTAAGTCTGTTCGACTTTTAAATTC
......T....G...........................G.....
......T.C..G...........................G.....
......T....G...........................G.....
......T....G...........................G.....
......T....G...........................G.....
120
OPNHM17I
OPNHM18I
OPNHM19I
OPAOND1
OPAOND2
OPAOND6
OPAOND10
IBET15
IBET18
IBET31
IBET35
IBET45
iOPV1
iOPV4
iOPV5
iOPV6
iOPV7
iOPV8
iOPV10
iOPV12
iKP1
iOPV13
iOPV14
iOPV15
iStelRiv1
iStelRiv2
iStelKun3
iStelBea2
iStelTr2
iStelRiv4
iStelKun1
iStelBon1
iStelBon4
iStelKen4
iStelKen1
iStelRob1
iStelRob2
iStelRob3
iUITWic11
iUITWic12
iUITWic13
iUITWic14
iUITWic15
iUITWic16
iUITWic17
iUITWic18
iUITWic19
iUITWic20
iUITWic21
iUITWic22
iUITWic23
......T....G...........................G.....
......T....G...........................G.....
......T....G...........................G.....
......T....G...........................G.....
......T.C..G...........................G.....
......T....G...........................G.....
......T....G...........................G.....
......T....G...........................G...C.
......T.A..G...........................G.....
......T.T..G...........................G.....
......T....G...........................G.....
......T....G...........................G...C.
......T....G...........................G.....
......T....G...........................G.....
......T....G.............C.C.......C.GAC.....
......T....G...........................G.....
....G.T....G.............C.G..C........G.....
......T....G...........................G.T.C.
......T....G...........................G.....
....G.T....G.............C.G..C........G.....
....G.T....G.............C.G..C........G.....
....G.T....G.............C.G..C........G.....
....G.T....G...........................G.T...
....G.T....G...........................G.T.C.
......T....G...........................G.T.C.
......T....G.............C.............G.T.C.
......T....G...........................G.T.C.
......T....G...........................G.T.C.
......T....G...........................G.T.C.
......T....G...........................G.T.C.
......T....G...........................G.T.C.
......T....G...........................G.T.C.
......T....G..................C........G.T.C.
......T....G...........................G.T.C.
......T....G...................GAC.....G.T.C.
......T....G...........................G.T.C.
....G.T....G...........................G.T.C.
......T....G...........................G.T.C.
....G.T....G...............G...........G.T.C.
......T....G...........................G.T.C.
....G.T....G...........................G.T.C.
......T....G...........................G.T.C.
....G.T....G...............G...........G.T.C.
......T...CGGC.........................G.T.C.
......T....G...........................G.T.C.
......T....G...........................G.T.C.
......T....G...........................G.T.C.
......T....G...........................G.T.C.
....G.T....G...........................G.T.C.
......T....G...........................G.T.C.
....G.T....G...............G...........G.T.C.
121
Appendix 6
Multiple alignment of the C. bolitinos nucleotide sequences of the 16S rRNA partial gene fragment
for all 52 individuals from different geographic areas. Culicoides tuttifrutti (tuttiNHMT15) sequence
was used as a reference species to generate the alignment. Only the nucleotide sites that differ
from the tuttiNHMT15 are shown. The dots represent identical nucleotide sites and the symbol (-)
represent deletions. The alignment was used to compare the C. bolitinos individuals of all sampled
populations. The alignment was generated using the Clustal X program.
122
tuttiNHMT15
bCLA8
bCLA9
bCLA10
bCLA11
bCLA12
bCLA13
bCLA14
bCLA15
bCLA16
bCLA17
bCLA18
bCLA19
bCLA20
bGEO4
bGEO6
bGEO7
bGEO8
bGEO9
bGEO10
bGEO11
bGEO12
bGEO13
bGEO14
bGEO1
bGEO3
bGEO5
bStelRos1
bStelRos2
bStelRos3
bStelRos4
bStelRos5
bStelRos6
bStelRos7
bStelRos8
bStelRos9
bStelRos10
bStelRob3
bStelFar1
bStelFar2
bPEAsc7
bPEAsc8
bPEAsc9
bPEAsc10
bPEAsc11
bPEAsc12
bPEAsc13
bPEAsc14
bPEAsc15
bPEAsc16
bPEAsc17
bPEAsc18
bPEAsc19
10
20
30
40
50
60
70
80
....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|
CTGTGCAAAGGTAGCATAATCCATTGTCTTTTAATTAAAGGCTAGTATGAATGGTTGGATGAGATATC
CAGTATACCCGA.................GCAATC.CTGACA..T..........T.............A.........T
CAGTATACCCGA.............................................A.................G....
CAGTATACCCGA.................GCGATC.CTGACA..T..........T.............A.........T
CAGTATACCCGA....................ATC.CTGA.A..T..........T.............A.........T
CAGTATACCCGA....................ATC.CTGA.A.............T.............A.........T
CAGTATACCCGA.............T.........A.TGACA..T..........T.............A.........T
CAGTATACCCGA.............T......ATCA.TGA.A..T..........T.............A.........T
CAGTATACCCGA.............T......ATCC.C.GAA..T..........T.............A.........T
CAGTATACCCGA.............T..............AA..T..........T.............A.........T
CAGTATACCCGA.............T..............AA.............T.....C.......A.........T
CAGTATACCCGA.................GCA.........................A.................G....
CAGTATACCCGA.............................................A.................G....
CAGTATACCCGA.......................C.....................A.................G....
CAGTATACCCGA.............................................A.................G....
CAGTATACCCGA.............................................A.................G....
CAGTATACCCGA................................T............A...........A.........T
CAGTATACCCGA......................................C......A...........A.........T
CAGTATACCCGA.............................................A...........A.........T
CAGTATACCCGA.............................................A.................G....
CAGTATACCCGA................................T............A...........A.........T
CAGTATACCCGA......................................C......A.................G....
CAGTATACCCGA......................................C......A...........A.........T
CAGTATACCCGA.............................................A...........A.........T
CAGTATACCCGA.............................................A.................G....
CAGTATACCCGA.............................................A.................G....
CAGTATACCCGA.............................................A.................G....
CAGTATACCCGA.............................................A.................G....
CAGTATACCCGA................................T............A...........A.........T
CAGTATACCCGA.............................................A.................G....
CAGTATACCCGA..........................A.A................A...........A.........T
CAGTATACCCGA................................T............A...........A.........T
CAGTATACCCGA.............................................A.................G....
CAGTATACCCGA.............................................A.................G....
CAGTATACCCGA......................CA.....................A.................G....
CAGTATACCCGA.............................................A.................G....
CAGTATACCCGA.............................................A.................G....
CAGTATACCCGA.............................................A.................G....
CAGTATACCCGA.............................................A.................G....
CAGTATACCCGA.............................................A.................G....
CAGTATACCCGA.............................................A.................G....
CAGTATACCTGA.............................................A.................G....
CAGTATACCCGA.............................................A.................G....
CAGTATACCTGA.............................................A.................G....
CAGTATACCCGA.............................................A.................G....
CAGTATACCCGA.............................................A.........G.......G....
CAGTATACCCGA.............................................A.................G....
CAGTATACCCGA.......................C.....................A.................G....
CAGTATACCCGA.......................C.....................A.................G....
CAGTATACCTGA.......................C.....................A.........G.......G....
CAGTATACCCGA.............................................A.................G....
CAGTATACCCGA.......................C.....................A.................G....
CAGTATACCCGA.............................................A.........G.......G....
tuttiNHMT15
bCLA8
bCLA9
bCLA10
bCLA11
bCLA12
bCLA13
bCLA14
bCLA15
bCLA16
bCLA17
bCLA18
bCLA19
bCLA20
bGEO4
bGEO6
bGEO7
bGEO8
bGEO9
90
100
110
120
130
140
150
160
....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|
AACTATTTTTATTTTAATAAAAATGAATTTTAATTTTTAGTAAAAATGCTAAAATAAAAAAATTAGACGAGAAGACCCTA
.....C.............................................C............................
................................................................................
.....C..........................................................................
................................................................................
....C...........................................................................
....C...........................................................................
....C...........................................................................
................................................................................
....C...........................................................................
.....C..........................................................................
................................................................................
................................................................................
................................................................................
................................................................................
................................................................................
TC..............................................................................
TC...C..................................C.......................................
TC..............................................................................
123
bGEO10
bGEO11
bGEO12
bGEO13
bGEO14
bGEO1
bGEO3
bGEO5
bStelRos1
bStelRos2
bStelRos3
bStelRos4
bStelRos5
bStelRos6
bStelRos7
bStelRos8
bStelRos9
bStelRos10
bStelRob3
bStelFar1
bStelFar2
bPEAsc7
bPEAsc8
bPEAsc9
bPEAsc10
bPEAsc11
bPEAsc12
bPEAsc13
bPEAsc14
bPEAsc15
bPEAsc16
bPEAsc17
bPEAsc18
bPEAsc19
................................................................................
TC..............................................................................
.....C............................................C.............................
TC...C..................................C.......................................
TC..............................................................................
................................................................................
................................................................................
................................................................................
................................................................................
TC..............................................................................
................................................................................
TC..............................................................................
TC..............................................................................
................................................................................
................................................................................
................................................................................
................................................................................
................................................................................
................................................................................
................................................................................
................................................................................
................................................................................
................................................................................
................................................................................
................................................................................
................................................................................
................................................................................
................................................................................
................................................................................
................................................................................
.......................GA.......................................................
................................................................................
................................................................................
................................................................................
tuttiNHMT15
bCLA8
bCLA9
bCLA10
bCLA11
bCLA12
bCLA13
bCLA14
bCLA15
bCLA16
bCLA17
bCLA18
bCLA19
bCLA20
bGEO4
bGEO6
bGEO7
bGEO8
bGEO9
bGEO10
bGEO11
bGEO12
bGEO13
bGEO14
bGEO1
bGEO3
bGEO5
bStelRos1
bStelRos2
bStelRos3
bStelRos4
bStelRos5
bStelRos6
bStelRos7
bStelRos8
bStelRos9
bStelRos10
bStelRob3
bStelFar1
bStelFar2
170
180
190
200
210
220
230
240
....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|
TAAATCTTTATTTTATAAATAATAATATTAATTTTGTAAATTTTTTAATAATTATTTTTAAAAAATTTTATTGGGAGGAT
........A.......TTT.T...............A........A.TA......AAAA.T...................
...................A.........................A.T..G........C....................
........A.......TTT.T...............A........A.TA......AAAA.T...................
........A.......TTT.T...............A........A.TA......AAAA.T...................
........A.......TTT.T...............A........A.TA......AAAA.T..........G........
........A.......TTT.T...............A........A.TA......AAAA.T...................
........A.......TTT.T...............A........A.TA......AAAA.T...................
........A.......TTT.T...............A........A.TA......AAAA.T...................
........A.......TTT.T...............A........A.TA......AAAA.T...................
........A.......TTT.T...............A........A.TA......AAAA.T...................
...................A.........................A.T..G........C....................
...................A.........................A.T..G........C....................
...................A.........................A.T..G........C....................
...................A.........................A.T..G........C....................
...................A.........................A.T..G........C....................
.................................AA.A.......CA.TA..........T................A...
.................................AA.A.......CA.TA..........T................A...
.................................AA.A.......CA.TA..........T................A...
...................A.........................A.T..G........C....................
.................................AA.A.......CA.TA..........T................A...
...................A.........................A.T..G........C....................
.................................AA.A.......CA.TA..........T................A...
.................................AA.A.......CA.TA..........T................A...
...................A.........................A.T..G........C....................
...................A.........................A.T..G........C....................
...................A.........................A.T..G........C....................
...................A.........................A.T..G........C....................
.................................AA.A.......CA.TA..........T................A...
...................A.........................A.T..G........C....................
.................................AA.A.......CA.TA..........T................A...
.................................AA.A.......CA.TA..........T................A...
...................A.........................A.T..G........C....................
...................A.........................A.T..G........C....................
...................A.........................A.T..G........C....................
...................A.........................A.T..G........C....................
...................A.........................A.T..G........C....................
...................A.........................A.T..G........C....................
...................A.........................A.T..G........C....................
...................A.........................A.T..G........C....................
124
bPEAsc7
bPEAsc8
bPEAsc9
bPEAsc10
bPEAsc11
bPEAsc12
bPEAsc13
bPEAsc14
bPEAsc15
bPEAsc16
bPEAsc17
bPEAsc18
bPEAsc19
...................A.........................A.T..G........C....................
...................A.........................A.T..G........C....................
...................A.........................A.T..G........C....................
...................A.........................A.T..G........C....................
...................A.........................A.T..G........C....................
...................A.........................A.T..G........C....................
...................A.........................A.T..G........C....................
...................A.........................A.T..G........C....................
...................A.........................A.T..G........C....................
...................A.........................A.T..G........C....................
...................A.........................A.T..G........C....................
...................A.........................A.T..G........C....................
...................A.........................A.T..G........C....................
tuttiNHMT15
bCLA8
bCLA9
bCLA10
bCLA11
bCLA12
bCLA13
bCLA14
bCLA15
bCLA16
bCLA17
bCLA18
bCLA19
bCLA20
bGEO4
bGEO6
bGEO7
bGEO8
bGEO9
bGEO10
bGEO11
bGEO12
bGEO13
bGEO14
bGEO1
bGEO3
bGEO5
bStelRos1
bStelRos2
bStelRos3
bStelRos4
bStelRos5
bStelRos6
bStelRos7
bStelRos8
bStelRos9
bStelRos10
bStelRob3
bStelFar1
bStelFar2
bPEAsc7
bPEAsc8
bPEAsc9
bPEAsc10
bPEAsc11
bPEAsc12
bPEAsc13
bPEAsc14
bPEAsc15
bPEAsc16
bPEAsc17
bPEAsc18
bPEAsc19
250
260
270
280
290
300
310
320
....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|
AATGAAATTTAATAAACTTTTATTCTAATTT-ATAAATATAATTAAATTAATGAATATATTATTATAAAATGTTTAAAAA
........................T.TT...T..................TG........A..........A........
........................T..T...T............................A...................
........................T.TT...T..................TG........A..........A........
........................T.TT...T..................TG........A..........A........
........................T.TT...T..................TG........A..........A........
........................T.TT...T..................TG........A..........A........
........................T.TT...T..................TG........A..........A........
........................T.TT...T..................TG........A..........A........
........................T.TT...T..................TG........A..........A........
........................T.TT...T..................TG........A...G......A........
........................T..T...T............................A...................
........................T..T...T............................A...................
........................T..T...T............................A...................
........................T..T...T............................A...T...............
........................T..T...T............................A...T...............
..........T.A...........T.G....T..............T...T.........A...T......A........
..........T.A...........T.G....T..............T...T.........A...T......A........
..........T.A...........T.G....T..............T...T.........A...T......A........
........................T..T...T............................A...T...............
..........T.A...........T.G....T..............T...T.........A...T......A........
..G.....................T..T...T.......................GG...A...T...............
..........T.A...........T.G....T..............T...T.........A...T......A........
..........T.A...........T.G....T..............T...T.........A...T......A........
........................T..T...T............................A...T...............
........................T..T...T............................A...T...............
........................T..T...T............................A...T...............
........................T..T...T............................A...T...............
..........T.A...........T.G....T..............T...T.........A...T......A........
........................T..T...T............................A...T...............
..........T.A...........T.G....T..............T...T.........A...T......A........
..........T.A...........T.G....T..............T...T.........A...T......A........
........................T..T...T............................A...T...............
........................T..T...T............................A...T...............
........................T..T...T............................A...T...............
........................T..T...T............................A...T...............
........................T..T...T............................A...T...............
........................T..T...T............................A...T...............
........................T..T...T............................A...T...............
........................T..T...T............................A...T...............
........................T..T...T............................A...T...............
........................T..T...T............................A...T...............
........................T..T...T............................A...T...............
........................T..T...T............................A...T...............
........................T..T...T............................A...T...............
........................T..T...T............................A...T...............
........................T..T...T............................A...T...............
........................T..T...T............................A...T...............
........................T..T...T............................A...T...............
........................T..T...T............................A...T...............
........................T..T...T............................A...T...............
........................T..T...T............................A...T...............
........................T..T...T............................A...T...............
tuttiNHMT15
bCLA8
bCLA9
bCLA10
bCLA11
330
340
350
360
370
380
390
400
....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|
ATTAAGTTACTTTAGGGATAACAGCGTAATTATTTTAAAGAGTTCTTATCGACAAAATAGTTTGCGACCTCGATGTTGAA
....G...C...........................................T...........................
....................................................T...........................
....G...C...........................................T...........................
........C...........................................T...........................
125
bCLA12
bCLA13
bCLA14
bCLA15
bCLA16
bCLA17
bCLA18
bCLA19
bCLA20
bGEO4
bGEO6
bGEO7
bGEO8
bGEO9
bGEO10
bGEO11
bGEO12
bGEO13
bGEO14
bGEO1
bGEO3
bGEO5
bStelRos1
bStelRos2
bStelRos3
bStelRos4
bStelRos5
bStelRos6
bStelRos7
bStelRos8
bStelRos9
bStelRos10
bStelRob3
bStelFar1
bStelFar2
bPEAsc7
bPEAsc8
bPEAsc9
bPEAsc10
bPEAsc11
bPEAsc12
bPEAsc13
bPEAsc14
bPEAsc15
bPEAsc16
bPEAsc17
bPEAsc18
bPEAsc19
........C...........................................T...........................
........C...........................................T...........................
........C...........................................T...........................
........C...........................................T...........................
........C...........................................T...........................
....G...C...........................................T...........................
....................................................T...........................
....................................................T...........................
....................................................T...........................
....................................................T...........................
....................................................T...........................
.....................................G....C.........T.....T.....................
.....................................G....C.........T.....T.....................
.....................................G....C.........T.....T.....................
....................................................T...........................
.....................................G....C.........T.....T.....................
....................................................T.................A.........
.....................................G....C.........T.....T.....................
.....................................G....C.........T.....T.....................
....................................................T...........................
....................................................T...........................
....................................................T...........................
....................................................T...........................
.....................................G....C.........T.....T.....................
....................................................T...........................
.....................................G....C.........T.....G.....................
.....................................G....C.........T.....T.....................
....................................................T...........................
....................................................T...........................
....................................................T...........................
....................................................T...........................
....................................................T...........................
....................................................T...........................
....................................................T...........................
....................................................T...........................
....................................................T...........................
....................................................T...........................
....................................................T...........................
....................................................T...........................
....................................................T...........................
..........................................A.........T...........................
....................................................T...........................
....................................................T...........................
....................................................T...........................
....................................................T...........................
....................................................T...........................
....................................................T...........................
..........................................A.........T...........................
tuttiNHMT15
bCLA8
bCLA9
bCLA10
bCLA11
bCLA12
bCLA13
bCLA14
bCLA15
bCLA16
bCLA17
bCLA18
bCLA19
bCLA20
bGEO4
bGEO6
bGEO7
bGEO8
bGEO9
bGEO10
bGEO11
bGEO12
bGEO13
bGEO14
bGEO1
bGEO3
410
420
430
440
450
....|....|....|....|....|....|....|....|....|....|....|...
TTAAGAATTAATTTAGGTGCAGAAATTTAAATTTTAAGTCTGTTCG
......G.A..........T....G.....................
......G.A..........T....G.....................
......G.A..........T....G.....................
......G.A..........T....G.....................
......G.A..........T....G.....................
......G.A..........T....G.....................
......G.A..........T....G.....................
......G.A..........T....G.....................
......G.A..........T....G.....................
......G.A..........T....G.....................
......G.A..........T....G.....................
......G.A..........T....G.....................
......G.A..........T....G.....................
......G.A..........T....G.....................
......G.A..........A....G.....................
...............AA....A..G.....................
.............A.A.CAA.A..G.....................
...............AA....A..G.....................
......G.A..........A....G.....................
...............AA....A..G.....................
......G..............A..G.....................
.............A.A.CAA.A..G.....................
...............AA....A..G.....................
......G.A..........T....G.....................
......G.A..........T....G.....................
126
bGEO5
bStelRos1
bStelRos2
bStelRos3
bStelRos4
bStelRos5
bStelRos6
bStelRos7
bStelRos8
bStelRos9
bStelRos10
bStelRob3
bStelFar1
bStelFar2
bPEWic7
bPEAsc8
bPEAsc9
bPEAsc10
bPEAsc11
bPEAsc12
bPEAsc13
bPEAsc14
bPEAsc15
bPEAsc16
bPEAsc17
bPEAsc18
bPEAsc19
......G.A..........T....G.....................
......G.A..........T....G.....................
...............AA....A..G.....G...............
......G.A..........T....G.....................
.............A.A.CA.CA..G.....................
...............AA....A..G.....................
......G.A..........T....G.....................
......G.A..........T....G.....................
......G.A..........T....G...............C.....
......G.A..........T....G.....................
......G.A..........T....G.....................
......G.A..........T....G.....................
......G.A..........T....G.....................
......G.A..........T....G.....................
......G.A..........T....G.....................
......G.A..........T....G.....................
......G.A..........T....G.....................
......G.A..........T....G.....................
......G.A..........T....G.....................
......G.A..........T....G.....................
......G.A..........T....G.....................
......G.A..........T....G.....................
......G.A..........T....G.....................
......G.A..........T....G.....................
......G.A..........T....G.....................
......G.A..........T....G.....................
......G.A..........T....G.....................
127
Fly UP